Skip to main content


We’d like to understand how you use our websites in order to improve them. Register your interest.

A Gossypium BAC clone contains key repeat components distinguishing sub-genome of allotetraploidy cottons



Dissecting genome organization is indispensable for further functional and applied studies. As genome sequences data shown, cotton genomes contain more than 60 % repetitive sequences, so study on repetitive sequences composition, structure, and distribution is the key step to dissect cotton genome.


In this study, a bacterial artificial chromosome (BAC) clone enriched in repetitive sequences, was discovered initiatively by fluorescence in situ hybridization (FISH). FISHing with allotetraploidy cotton as target DNA, dispersed signals on most regions of all A sub-genome chromosomes, and only middle regions of all D sub-genome chromosomes were detected. Further FISHing with other cotton species bearing A or D genome as target DNA, specific signals were viewed. After BAC sequencing and bioinformational analysis, 129 repeat elements, size about 57,172 bp were found, accounting for more than 62 % of the BAC sequence (91,238 bp). Among them, a type of long terminal repeat-retrotransposon (LTR-RT), LTR/Gypsy was the key element causing the specific FISH results. Using the fragments of BAC matching with the identified Gypsy-like LTR as probes, the BAC-57I23-like FISH signals were reappeared. Running BLASTN, the fragments had good match with all chromosomes of G. arboreum (A2) genome and A sub-genome of G. hirsutum (AD1), and had relatively inferior match with all chromosomes of D sub-genome of AD1, but had little match with the chromosomes of G. raimondii (D5) genome, which was consistent with the FISH results.


A repeats-enriched cytogenetic marker to identify A and D sub-genomes of Gossypium was discovered by FISH. Combined sequences analysis with FISH verification, the assembly quality of repetitive sequences in the allotetraploidy cotton draft genome was assessed, and better chromosome belonging was verified. We also found the genomic distribution of the identified Gypsy-LTR-RT was similar to the distribution of heterochromatin. The expansion of this type of Gypsy-LTR-RT in heterochromatic regions may be one of the major reasons for the size gap between A and D genome. The findings showed here will help to understand the composition, structure, and evolution of cotton genome, and contribute to the further perfection of the draft genomes of cotton.


Gossypium, as one of the best-characterized allopolyploid species, is divided into eight diploid genome groups (2n = 2× = 26), namely A-G and K, and one allotetraploidy genome group (2n = 4× = 52), which is allotetraploid bearing A and D genomes [1, 2]. So far, approximately 45 diploid and 6 tetrapolyploid Gossypium species are recognized [3, 4]. Among them, four cultivated species, the New World allopolyploids G. hirsutum and G. barbadense (2n = 4× = 52), and the Old World diploids G. arboreum and G. herbaceum (2n = 2× = 26), especially G. hirsutum, dominate worldwide cotton production. For a long time, cotton has been firmly established as the world’s most important fiber crop and an important source of seed oil and protein meal [5].

The two progenitors of allotetraploidy cotton diverged 4–8 million years ago, and re-hybridized about 1–2 million years ago [6, 7]. There is enough time for sequence divergence, as well as subsequent genome stability. What’s more, there is a wide range in genome size across closely related diploid species (from 880 Mb to 2572 Mb per haploid nucleus) and well-established phylogeny in Gossypium [8]. So, cotton is also an excellent model system for studying polyploidization, genomic organization, and genome-size variation. To dissect the genomic complexity in allotetraploidy cotton, extensive efforts have been performed. The ployploid parentage had been explained with the help of series of cytogenetic data combined with the observation derived from different studies. In early years, based on some classic cytogenetic and cytological studies, genome composition of the polyploids was investigated, which confirmed that the American allotetraploidy species are allopolyploids containing two resident genomes, an A-genome from Africa or Asia, and a D-genome similar to those found in the American diploids [911]. With the extensive application of FISH, more evidences that allotetraploidy cottons may be polyphyly have been obtained [12, 13].

It is believed that the proportion of protein-coding sequences is generally similar in different plant species [14], and repetitive DNA sequences are important factors in genome size variation [1517]. Repetitive sequences can be classified into two categories: tandem repeats and transposable elements [18]. The former, which is usually found in specific genomic regions, such as centromeres or telomeres, has been extensively studied in different plant species [1924]. Among the latter, retrotransposons replicating through a ‘copy and paste’ mechanism can result in the increase of the genome size to a great extent. Different methods had been used for analysis of repetitive DNA sequences, such as the low C0t analysis [25, 26], bacterial artificial chromosome (BAC) end sequences analysis [27], full-length BAC sequences analysis [28, 29]. To date, the most powerful method to characterize the high copy fraction of a genome is next generation sequencing and subsequent bioinformatic analysis [30, 31]. Recently, the draft assemblies of cotton genomes have been reported. More than 60 % of repetitive DNA sequences in genomes were revealed [3236]. So dissecting the repetitive DNA sequences of genome is helpful to further understand the composition, evolution, and function of the cotton genome.

Fluorescence in situ hybridization (FISH), which allows direct mapping of DNA sequences on chromosomes, has become the most important technique in plant molecular cytogenetics [37]. Unique distribution patterns of repetitive DNA sequences on chromosomes has been revealed by FISH [38, 39], which provided a wealth of information regarding the chromosomal location of repetitive DNA sequences and their evolution in polyploidy genomes.

Here we analyzed a repeats-rich BAC clone combining FISH verification with sequence analysis, and identified the key elements resulting in specific FISH signal patterns, that is, a type of long terminal repeat-retrotransposon (LTR-RT). Simultaneous FISH with different cotton species as target chromosomes provided visual cytogenetic evidences of the colonization and size variation of the genomes. Moreover, by integrating FISH results with the cotton draft genomes, we preliminarily assessed the assembly quality of the draft genome assemblies.


Plant materials and BAC library

The cultivated Gossypium species, G. hirsutum (AD1) (accession TM-1), G. barbadense (AD2) (cultivar Hai-7124), and G. arboreum (A2) (cultivar Shixiya-1) were planted at Institute of Cotton Research of Chinese Academy of Agricultural Sciences (CRI-CAAS) in Anyang City, Henan Province, China. The wild species G. tomentosum (AD3) (accession P0601211), G. mustelinum (AD4) (accession P0811704), G. darwinii (AD5) (accession AD5-7), G. raimondii (D5) (accession D5-2), and the artificial hexaploid cotton (G. hirsutum (AD1) x G. stocksii (E1)) are perennially growing in National Wild Cotton Nursery in Sanya city, Hainan Island, China. The BAC library of G. herbaceum var. africanum was constructed by Gao et al. [40].

BAC clone screening

During the screening of the 1th chromosome-specific BACs from the BAC library of G. herbaceum var. africanum, with SSR markers derived from a whole-genome marker map [41], the BAC clone 57I23 enriched in repeats was found. The corresponding SSR marker Gh216, with primers (F/R): TCCACATTCCCATGCACTACTC/CTAAAACCTTATACATACAAAATGCAGC was used to screen the BAC library according to Cheng et al. [42] with a few modifications.

BAC sequencing and repeats identification

The screened BAC clone 57I23 was sequenced and assembled by Shanghai Invitrogen Inc. Then BLASTN searches were performed using the BAC sequence as query, the draft genomes of cotton [33, 34, 36] as subjects respectively to detect the high copy repeats consisted in the BAC sequence. To further identify repeats types, online programs CENSOR ( [43], LTR-FINDER ( [44] were used with the default parameters.

Isolation of repeats

The primers of the selected repeats, with better match to genome or higher score in CENSOR results, were designed using NCBI primer-BLAST ( Touchdown PCR was performed to obtain amplification products with the BAC-57I23 bacterium as template. The amplification procedure was as follows: firstly, 98 °C 5 min for pre-degeneration; then 98 °C for 11 s, 52 + 1 °C for 18 s, 68 °C for 2.5 min for 10 cycles; 98 °C for 11 s, 57 °C for 18 s, 68 °C for 2.5 min for 30 cycles with a final extension at 68 °C for 6 min.

DNA probes preparation

To visualize the distribution of the BAC-57I23 and its repeat elements, FISH was performed using BAC-DNA and repeat elements as probes respectively. BAC-DNA was isolated using Plasmid Miniprep Kit (Biomiga) according to the handbook. The PCR products were purified using Wizard SV Gel and PCR Clean-up System (Promega). They were labeled with DIG-nick translation Mix, according to the instructions of the manufacturer (Roche, USA).

Chromosome preparation and FISH

Chromosome Preparation and the FISH procedure were conducted according to the previous protocols [45, 46]. The probes were detected with anti-digoxigenin-rhodamine (red) (Roche, USA). Images were captured using a CCD camera attached to a Zeiss Imager M1 microscope. Images were processed using Photoshop CS3.


Discovery of the repeat-rich BAC clone 57I23

During the screening of the 1th chromosome-specific BACs from the BAC library of G. herbaceum var. africanum, a genome-specific BAC clone 57I23 was obtained using SSR marker Gh216, which was genetically mapped to AD_chr.01 (At01) [47, 48]. FISHing with AD genome species as target DNA, the signals dispersed on the all chromosomes except the terminal areas of A sub-genome, and only middle areas of all D sub-genome chromosomes (Fig. 1a-e). So the FISH with BAC-57I23 can distinguish A sub-genome from D sub-genome simultaneously. Further FISHing with diploid A and D species, high coverage signals on all chromosomes of A genome were found (Fig. 1g), but hardly any signal on chromosomes of D genome (Fig. 1h). When using the artificial hexaploid hybrid (G. hirsutum x G. stocksii) preparation as target chromosomes, the similar A and D sub-genome signal patterns were observed, and none signal on E sub-genome (Fig. 1f). More than 15 metaphase cells with clear chromosome spreads were chosen to analyze the distribution of the FISH signals along the chromosomes. Based on the signal pattern, we deduced that the BAC clone 57I23 enriched in some types of repetitive elements.

Fig. 1

FISH mapping of BAC clone 57I23 on metaphase chromosomes of different Gossypium species. a-h: G. hirsutum (AD1, 2n = 4× = 52), G. barbadense (AD2, 2n = 4× = 52), G. tomentosum (AD3, 2n = 4× = 52), G. mustelinum (AD4, 2n = 4× = 52), G. darwinii (AD5, 2n = 4× = 52), hexaploid hybrid (G. hirsutum × G. stocksii) (AADDEE, 3n = 6× = 78), G. arboreum (A2, 2n = 2× = 26), G. raimondii (D5, 2n = 2× = 26). Red: the signal of BAC-57I23. Bar = 5 μm

BAC sequencing and BLASTN analysis

To further understand the composition of BAC-57I23, BAC sequencing was performed by Shanghai Invitrogen Inc. Due to the existence of enriched repetitive sequences, three scaffolds with size of scaffold1-42,338 bp, scaffold2-26,803 bp, scaffold3-22,097 bp were obtained, respectively.

By BLASTN using the BAC sequence as query and A2 draft genome (G. arboretum) [34] as subject sequence, we obtained ten DNA fragments (named after its sequence location in corresponding scaffold) from the BAC sequence, based on the more-than-80 % similarity and zero or approximate zero e-value. With the ten selected DNA fragments as query sequences, BLASTN were performed against D5 (G. raimondii) and AD1 (G. hirsutum) draft genomes [33, 36] respectively. After comparing the distribution of the ten fragments in different cotton genomes, it was found that the copy number was the highest in A2 genome, but 10–25 times lower in D5 genome (Fig. 2), and with very bad match hits (data not shown), which maybe partially explain the FISH results in D genome species. We extracted the sequences of the ten fragments from the BAC sequence for the following analysis.

Fig. 2

Copy number of the ten selected DNA fragments in A2, D5, and AD1 (Zhang et al. 2015 [36]) (hereafter we named it as AD1-NAU) genomes by BLASTN

At the same time, taking into account the FISH results of BAC-57I23 in AD genome species, we compared the total repeated numbers of ten fragments in every chromosome of AD genome (Fig. 3). Result showed that the A sub-genome chromosomes had more than 10 times of repeats copy numbers than D sub-genome, and better consistency with the FISH results was viewed.

Fig. 3

Total copy number of the ten fragments in every chromosome of AD1-NAU genome (At/Dt)

Identification of repetitive sequences

Based on CENSOR results, DNA transposon, LTR-RT, Non-LTR-RT, and other repetitive elements were identified from the BAC sequences, which account for more than 62 % of the assembled BAC sequence. Among them, LTR-RT was predominant, accounting for 88.11 % of total identified repetitive elements (55.21 to 62.66 %) (Fig. 4 and Table 1). The identified LTR-RTs were classified into LTR/Gypsy, LTR/Copia, LTR/BEL families. Especially, LTR/Gypsy accounted for more than 91 % of the total identified LTR-RTs. By combining the CENSOR with BLASTN analysis results, we selected 12 LTR-RTs with higher score value (Table 2), and extracted the corresponding sequences from the BAC sequences for FISH verification.

Fig. 4

Sequence analysis graphical map of the repeat-rich bacterial artificial chromosome (BAC) clone 57I23. Horizontal blue bars represent the BAC sequence, vertical bars represent different repeat elements. a, scaffold1-42338 bp; b, scaffold2-26803 bp; c, scaffold3-22097 bp

Table 1 Summary of identified repeats in BAC sequence by CENSOR
Table 2 Selected LTR-RTs from CENSOR results

When running LTR-FINDER (version 1.05) using BAC sequence as query sequence, a 4118 bp full-length LTR-RT was identified in sequence region of scaffold1 (13558-17675). It belonged to the LTR/Copia family, and overlapped with Copia-80_ST-I identified by CENSOR.

By RepeatMasker (RepeatMasker vesion open-4.0.5) analysis, a 659 bp (sca2 (20662-21331)) Gypsy/DIRSI LTR element was identified, which had overlap region with sca2 (18785-21330) from the CENSOR results.

For further FISH verification, the partial above-mentioned fragments and LTR-RTs were PCR amplified and purified. Each purified DNA fragment had single band and expected size, which suited for the following work.

Distribution of LTR-RTs in the cotton genomes

The FISH analysis of somatic metaphase chromosomes showed differential distribution patterns for each LTR-RT subfamily. When using Gypsy-48_GR-I-like LTR-RTs as probes, BAC-57I23-like signals were reappeared (Fig. 5a, d-i). Using sca3 (5355-8188) as probes, the FISH signals only were observed on chromosomes of A sub-genome with lower coverage relative to BAC 57I23 (Fig. 5b), and no signal on G. raimondii chromosomes (Fig. 5c). Using sca1 (13558-17675), a 4118 bp-LTR/Copia element as probe, only a few dotty signals appeared (Fig. 5j). But using sca2 (23904-25399), a Non-Gypsy-48_GR-I-like LTR-RT as probe, no signal appeared (Fig. 5k).

Fig. 5

FISH analysis of distribution of identified LTR-RTs in cotton genome. a, sca2 (18785-21330)- G. hirsutum; b, sca3 (5355-8188)- G. hirsutum; c, sca3 (5355-8188)- G. raimondii.; d, sca1 (4200-5326)- G. hirsutum; e, sca2 (7498-8637)- G. hirsutum; f, sca3 (17834-19556)- G. hirsutum; g, sca3 (20731-21832)- G. hirsutum; h, sca1 (4200-5326)- G. arboreum; i, sca1 (4200-5326)- G. raimondii; j, scaffold1 (13558-17675)- G. hirsutum; k, sca2 (23904-25399)- G. hirsutum; l, sca2 (18785-21330)- G. hirsutum (pachytene). Bar = 5 μm

Pachytene chromosomes can display a differentiated pattern of heterochromatic and euchromatic regions [46, 49]. The pachytene-FISH results of G. hirsutum using fragment sca2 (18785-21330) as probe, which belonging to Gypsy-48_GR-I-like LTR-RT, showed high signal density throughout the partial pachytene chromosomes mainly following the distribution of heterochromatin, as white arrow shown (Fig. 5l).


Sub-genome-specific cytogenetic marker

In early times, cotton chromosome identification was mainly based on the analysis of cytological characters, such as chromosomal relative lengths, arm ratios, and nuclear organization regions (NORs) in the mitotic or meiotic metaphase [50]. Because of the big number and small size of the chromosomes in cotton, the cytological identification of the chromosome has been hitherto limited. With the development of FISH, chromosome-specific FISH markers are effective tools for chromosome identification, analysis of genetic stocks, and physical mapping [13, 5153]. BAC-57I23 displayed here can be used as a sub-genome specific FISH marker to identify A and D sub-genomes simultaneously in AD genome cotton species or allohexaploids containing A and D sub-genomes, due to the different FISH signal patterns on A and D sub-genome chromosomes. The discovery of BAC-57I23 provided a new FISH marker for identification of two or three sub-genomes at the same time, so the one-BAC FISH with 57I23 can take the place of GISH (genomic in situ hybridization) with two or three genomes DNA to achieve the identification of the sub-genomes.

Assembly quality of repetitive sequences in allotetraploidy cotton draft genome

Decoding cotton genomes is a foundation for understanding the functional and agronomic significance of polyploidy and genome size variation within the Gossypium genus. But high-quality assembly of allopolyploid plant genomes is a formidable task because of the large genomes and the existence of highly homeologous sub-genomes [36]. Mis-assemblies are common when draft genome sequences have been generated by de novo assembly of sequences obtained with NGS technologies [54]. It’s possible that regions with repeated sequences might not be assembled successfully. FISH, allowing directly mapping of DNA sequences on chromosomes, has become an important technique in plant molecular cytogenetic research and can be used to guide draft genome assembly [37, 55, 56]. In this study, when blasting against the AD1-NAU draft genome using the identified repeats, the results had good consistency with the BAC-FISH results (Figs. 1 and 3). Based on this result, we can infer the assembly of the identified repetitive sequences in AD1-NAU draft genome has better matchup on their chromosome belonging.

Genome size expansion and LTR-RTs

In diploid cottons, the A genome (1697 Mb) has nearly twice the size of the D genome (885 Mb) [1, 5]. The sequences analysis of cotton draft genome indicates that the amount of sequence encompassing LTR-type retrotransposons increased from 348 Mb in G. raimondii to 1145 Mb in G. arboreum, whereas the protein-coding capacities of these two species remained largely unchanged [32, 34]. In this study, the significant difference of FISH signal patterns of the BAC-57I23 between A and D genomes indicated that the BAC-57I23 should have specific composition, which can partly explain the size gap between A and D genome (Fig. 1g, h). By sequence analysis, a type of Gypsy-like LTR-RTs was identified as the key element in the BAC. The genomic distribution of the identified Gypsy-LTR-RT was similar to the distribution of heterochromatin (Fig. 5l). The expansion of this type of Gypsy-LTR-RT in heterochromatic regions may be one of the major reasons for the size gap between A and D genome. Here we provided visualized evidence by FISH that the proliferation of a type of Gypsy-like LTR-RTs is one of the major reasons for genome size diversity between A and D, which further supported the former studies results [8, 57, 58].

The colonization of the genome

The previous studies showed that A-genome-specific dispersed repetitive sequences at the diploid level have colonized the D-genome at the polyploid level [38, 59]. Similarly, another study showed that a family of copia-like retrotransposable elements “horizontally” transferred across genomes following allopolyploid formation [60]. Page et al. discovered that approximately 900 kp of sequence in the polyploid genome have been converted from one genome to another in separate conversion events scattered across the genome by whole-genome re-sequencing [61]. Here, our results combined BAC-sequencing with FISH verification showed that a type of Gypsy-like LTR-RTs had high copies in G. arboreum (A2) genome, but none in the G. raimondii. (D5) genome (Fig. 5), however at the polyploidy level, obviously sequence expansion and colonization from A to D sub-genomes occurred, which dispersed on all D sub-genome chromosomes middle areas.


As an excellent system for studying genome evolution and polyploidization, cotton cytogenetic study is increasingly on the agenda. Combined sequences analysis with FISH verification, a new genome-specific cytogenetic marker for identification of sub-genome was discovered. The repetitive sequences assembly quality of the allotetraploidy cotton draft genome was verified preliminarily, that is, the chromosome belonging of the repeats in AD1 draft genome has good consistency with the BAC-FISH results. A type of Gypsy-like LTR-RTs identified from the BAC-57I23 can partially explain the size gap between A and D genome. During the process of polyploidization of cotton, “horizontally” transferred from the A sub-genome to D sub-genome The findings showed here will help to understand the composition, structure, and evolution of cotton genome, and also will contribute to the further perfection of the draft genomes of cotton, as well as provided the cytogenetic evidence for polyploidy formation.


  1. 1.

    Endrizzi JE, Turcotte EL, Kohel RJ. Genetics, cytogenetics, and evolution of Gossypium. Adv Genet. 1985;23:271–375.

  2. 2.

    Wendel JF, Schnabel A, Seelanan T. Bidirectional interlocus concerted evolution following allopolyploid speciation in cotton (Gossypium). Proc Natl Acad Sci U S A. 1995;92(1):280–4.

  3. 3.

    Fryxell PA. A revised taxonomic interpretation of Gossypium L. (Malvaceae). Rheedea. 1992;2:108–65.

  4. 4.

    Stewart JM, Craven LA, Brubaker C, Wendel JF. Gossypium anapoides (Malvaceae), a New Species from Western Australia. Novon. 2015;23(4):447–51.

  5. 5.

    Wendel JF, Cronn RC. Polyploidy and the evolutionary history of cotton. Adv Agron. 2003;78:139–86.

  6. 6.

    Seelanan T, Schnabel A, Wendel JF. Congruence and consensus in the cotton tribe. Syst Bot. 1997;22:259–90.

  7. 7.

    Wendel JF, Albert VA. Phylogenetics of the cotton genus (Gossypium L.): character-state weighted parsimony analysis of chloroplast DNA restriction site data and its systematic and biogeographic implications. Syst Bot. 1992;17:115–43.

  8. 8.

    Hawkins JS, Kim H, Nason JD, Wing RA, Wendel JF. Differential lineage-specific amplification of transposable elements is responsible for genome size variation in Gossypium. Genome Res. 2006;16(10):1252–61.

  9. 9.

    Webber JM. Interspecific hybridization in Gossypium and the meiotic behavior of F1 plants. J Agric Res. 1935;51:1047–70.

  10. 10.

    Skovsted A. Cytological studies in cotton. II. Two interspecific hybrids between Asiatic and New World cottons. J. Genet. 1934;28:407–24.

  11. 11.

    Beasley JO. The origin of American tetraploid Gossypium species. Am Nat. 1940;74:285–6.

  12. 12.

    Liu SH, Wang KB, Song GL, Wang CY, Liu F, Li SH, et al. Primary investigation on GISH-NOR in cotton. Chinese Sci Bull. 2005;50(5):425–9.

  13. 13.

    Gan YM, Chen D, Liu F, Wang CY, Li SH, Zhang XD, et al. Individual chromosome assignment and chromosomal collinearity in Gossypium thurberi, G. trilobum and D subgenome of G. barbadense revealed by BAC-FISH. Genes Genet Syst. 2011;86(3):165–74.

  14. 14.

    SanMiguel P, Tikhonov A, Jin YK, Motchoulskaia N, Zakharov D, Melake-Berhan A, et al. Nested retrotransposons in the intergenic regions of the maize genome. Science. 1996;274(5288):765–8.

  15. 15.

    Soltis DE, Soltis PS, Bennett MD, Leitch IJ. Evolution of genome size in the angiosperms. Am J Bot. 2003;90(11):1596–603.

  16. 16.

    Bennetzen JL, Ma J, Devos KM. Mechanisms of recent genome size variation in flowering plants. Ann Bot. 2005;95(1):127–32.

  17. 17.

    Lysak MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. The dynamic ups and downs of genome size evolution in Brassicaceae. Mol Biol Evol. 2009;26(1):85–98.

  18. 18.

    Kubis S, Schmidt T, Heslop-Harrison JS. Repetitive DNA elements as a major component of plant genomes. Ann Bot. 1998;82(Suppl):45–55.

  19. 19.

    Ananiev EV, Phillips RL, Rines HW. Chromosome-specific molecular organization of maize (Zea mays L.) centromeric regions. Proc Natl Acad Sci U S A. 1998;95(22):13073–8.

  20. 20.

    Copenhaver GP, Nickel K, Kuromori T, Benito MI, Kaul S, Lin X, et al. Genetic definition and sequence analysis of Arabidopsis centromeres. Science. 1999;286(5449):2468–74.

  21. 21.

    Kishii M, Nagaki K, Tsujimoto HA. Tandem repetitive sequence located in the centromeric region of common wheat (Triticum aestivum) chromosomes. Chromosome Res. 2001;9(5):417–28.

  22. 22.

    Cheng ZK, Dong GF, Langdon TL, Ouyang S, Buell CR, Gu MH, et al. Functional rice centromeres are marked by a satellite repeat and a centromere-specific retrotransposon. Plant Cell. 2002;14(8):1691–704.

  23. 23.

    Kulikova O, Geurts R, Lamine M, Kim DJ, Cook DR, Leunissen J, et al. Satellite repeats in the functional centromere and pericentromeric heterochromatin of Medicago truncatula. Chromosoma. 2004;113(6):276–83.

  24. 24.

    Fajkus J, Sykorova E, Leitch AR. Telomeres in evolution and evolution of telomeres. Chromosome Res. 2005;13(5):469–79.

  25. 25.

    Ho ISH, Leung FC. Isolation and characterization of repetitive DNA sequences from Panax ginseng. Mol Genet Genomics. 2002;266(6):951–61.

  26. 26.

    Liu WX, Thummasuwan S, Sehgal SK, Chouvarine P, Peterson DG. Characterization of the genome of bald cypress. BMC Genomics. 2011;12:553.

  27. 27.

    Hong CP, Lee SJ, Park JY, Plaha P, Park YS, Lee YK, et al. Construction of a BAC library of Korean ginseng and initial analysis of BAC-end sequences. Mol Genet Genomics. 2004;271(6):709–16.

  28. 28.

    Choi HI, Waminal NE, Park HM, Kim NH, Choi BS, Park M, et al. Major repeat components covering one-third of the ginseng (Panax ginseng C.A. Meyer) genome and evidence for allotetraploidy. Plant J. 2014;77(6):906–16.

  29. 29.

    Tamura M, Hisataka Y, Moritsuka E, Watanabe A, Uchiyama K, Futamura N, et al. Analyses of random BAC clone sequences of Japanese cedar, Cryptomeria japonica. Tree Genet Genomes. 2015;11(3):50.

  30. 30.

    Macas J, Neumann P, Navratilova A. Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula. BMC Genomics. 2007;8:427.

  31. 31.

    Novak P, Neumann P, Macas J. Graph-based clustering and characterization of repetitive sequences in next-generation sequencing data. BMC Bioinformatics. 2010;11:378. doi:10.1186/1471-2105-11-378.

  32. 32.

    Wang KB, Wang ZW, Li FG, Ye WW, Wang JY, Song GL, et al. The draft genome of a diploid cotton Gossypium raimondii. Nat Genet. 2012;44(10):1098–103.

  33. 33.

    Paterson AH, Wendel JF, Gundlach H, Guo H, Jenkins J, Jin DC, et al. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature. 2012;492(7429):423–7.

  34. 34.

    Li FG, Fan GY, Wang KB, Sun FM, Yuan YL, Song GL, et al. Genome sequence of the cultivated cotton Gossypium arboreum. Nat Genet. 2014;46(6):567–72.

  35. 35.

    Li FG, Fan GY, Lu CR, Xiao GH, Zou CS, Kohel RJ, et al. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution. Nat Biotechnol. 2015;33(5):524–30.

  36. 36.

    Zhang TZ, Hu Y, Jiang WK, Fang L, Guan XY, Chen JD, et al. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nat Biotechnol. 2015;33(5):531–7.

  37. 37.

    Jiang JM, Gill BS. Current status and the future of fluorescence in situ hybridization (FISH) in plant genome research. Genome. 2006;49(9):1057–68.

  38. 38.

    Hanson RE, Zhao XP, Islam-Faridi MN, Paterson AH, Zwick MS, Crane CF, et al. Evolution of interspersed repetitive elements in Gossypium (Malvaceae). Am J Bot. 1998;85(10):1364–8.

  39. 39.

    Luo S, Mach J, Abramson B, Ramirez R, Schurr R, Barone P, et al. The cotton centromere contains a Ty3-gypsy-like LTR Retroelement. PLoS ONE. 2012; 7(4): doi:10.1371/journal.pone.0035261

  40. 40.

    Gao HY, Wang HF, Liu F, Peng RH, Zhang Y, Cheng H, et al. Construction of the bacterial artificial chromosome library of G. herbaceum var. africanum. Chinese Sci Bull. 2013;58(26):3199–201.

  41. 41.

    Wang ZN, Zhang D, Wang XY, Tan X, Guo H, Paterson AH. A whole-genome DNA marker map for cotton based on the D-genome sequence of Gossypium raimondii L. Genes Genom Genet. 2013;3(10):1759–67.

  42. 42.

    Cheng H, Peng RH, Zhang XD, Liu F, Wang CY, Wang KB. A rapid method to screen BAC library in cotton. Biotechnology (In Chinese). 2012;22(3):55–7.

  43. 43.

    Kohany O, Gentles AJ, Hankus L, Jurka J. Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor. BMC Bioinformatics. 2006;7:474.

  44. 44.

    Xu Z, Wang H. LTR_FINDER: an efficient tool for the prediction of full-length LTR retrotransposons. Nucleic Acids Res. 2007;35(Web Server issue):W265–8.

  45. 45.

    Jiang JM, Gill BS, Wang GL, Ronald PC, Ward DC. Metaphase and interphase fluorescence in situ hybridization mapping of the rice genome with bacterial artificial chromosomes. Proc Natl Acad Sci U S A. 1995;92(10):4487–91.

  46. 46.

    Peng RH, Zhang T, Liu F, Ling J, Wang CY, Li SH, et al. Preparations of miotic pachytene chromosomes and extended DNA fibers from cotton suitable for fluorescence in situ hybridization. PLoS ONE. 2012; 7(3): doi:10.1371/journal.pone.0033847.

  47. 47.

    Yu Y, Yuan D, Liang S, Li X, Wang X, Lin Z, et al. Genome structure of cotton revealed by a genome-wide SSR genetic map constructed from a BC1 population between gossypium hirsutum and G. barbadense. BMC Genomics. 2011;12:15. doi:10.1186/1471-2164-12-15.

  48. 48.

    Yu JZ, Kohel RJ, Fang DD, Cho J, Van Deynze A, Ulloa M, et al. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome. Genes Genom Genet. 2012;2(1):43–58.

  49. 49.

    De Jong JH, Fransz P, Zabel P. High resolution FISH in plants – techniques and applications. Trends Plant Sci. 1999;4(7):258–63.

  50. 50.

    Wang KB, Li MX. The karyotype variation and evolution of D genome in Gossypium. Acta Agron Sin. 1990;16(3):200–7.

  51. 51.

    Kim JS, Childs KL, Islam-Faridi MN, Menz MA, Klein RR, Klein PE, et al. Integrated karyotyping of sorghum by in situ hybridization of landed BACs. Genome. 2002;45(2):402–12.

  52. 52.

    Wang K, Guo W, Zhang T. Development of one set of chromosome-specific microsatellite-containing BACs and their physical mapping in Gossypium hirsutum L. Theor Appl Genet. 2007;115(5):675–82.

  53. 53.

    Gan YM, Liu F, Peng RH, Wang CY, Li SH, Zhang XD, et al. Individual chromosome identification, chromosomal collinearity and genetic physical integrated map in Gossypium darwinii and four D genome cotton species revealed by BAC-FISH. Genes Genet Syst. 2012;87(4):233–41.

  54. 54.

    Alkan C, Sajjadian S, Eichler EE. Limitations of next-generation genome sequence assembly. Nat Methods. 2011;8(1):61–5.

  55. 55.

    Yang L, Koo DH, Li Y, Zhang X, Luan F, Havey MJ, et al. Chromosome rearrangements during domestication of cucumber as revealed by high-density genetic mapping and draft genome assembly. Plant J. 2012;71(6):895–906.

  56. 56.

    Sun JY, Zhang ZH, Zong X, Huang SW, Li ZY, Han YH. A high-resolution cucumber cytogenetic map integrated with the genome assembly. BMC Genomics. 2013;14:461.

  57. 57.

    Hawkins JS, Proulx SR, Rapp RA, Wendel JF. Rapid DNA loss as a counterbalance to genome expansion through retrotransposon proliferation in plants. Proc Natl Acad Sci U S A. 2009;106(42):17811–6.

  58. 58.

    Grover CE, Wendel JF. Recent insights into mechanisms of genome size change in plants. J Bot. 2010. doi:10.1155/2010/382732.

  59. 59.

    Zhao XP, Si Y, Hanson RE, Crane CF, Price HJ, Stelly DM, et al. Dispersed repetitive DNA has spread to new genomes since polyploid formation in cotton. Genome Res. 1998;8(5):479–92.

  60. 60.

    Hanson RE, Islam-Faridi MN, Crane CF, Zwick MS, Czeschin DG, Wendel JF, et al. Ty1-copia-retrotransposon behavior in a polyploid cotton. Chromosome Res. 1999;8(1):73–6.

  61. 61.

    Page JT, Huynh MD, Liechty ZS, Grupp K, Stelly D, Ashrafi AH, et al. Insights into the evolution of cotton diploids and polyploids from whole-genome resequencing. Genes Genom Genet. 2013;3(10):1809–18.

Download references

Author information



Corresponding authors

Correspondence to Zhongxu Lin or Kunbo Wang.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

YL: Design of the study; Performed most of the experiments, manuscript writing. KW, RP, FL, ZL: Design of the study; Manuscript corrections; Supervision. XW, XC, CW, XC, YW, ZZ: Participated in the experiments, Manuscript corrections. All authors read and approved the final version of the manuscript.


This study was financially supported in part by a grant from the National Natural Science Foundation of China (No. 31471548), State Key Laboratory of Cotton Biology Open Fund (No.CB2014A07), National High Technology Research and Development Program (No.2013AA102601).

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Liu, Y., Peng, R., Liu, F. et al. A Gossypium BAC clone contains key repeat components distinguishing sub-genome of allotetraploidy cottons. Mol Cytogenet 9, 27 (2016).

Download citation


  • Gossypium
  • BAC
  • Repetitive sequences
  • LTR-RT
  • FISH