Skip to content


Open Access

First insights on the retroelement Rex1 in the cytogenetics of frogs

  • Juliana Nascimento1,
  • Diego Baldo2 and
  • Luciana Bolsoni Lourenço1Email author
Molecular Cytogenetics20158:86

Received: 7 August 2015

Accepted: 27 October 2015

Published: 5 November 2015



While some transposable elements (TEs) have been found in the sequenced genomes of frog species, detailed studies of these elements have been lacking. In this work, we investigated the occurrence of the Rex1 element, which is widespread in fish, in anurans of the genus Physalaemus. We isolated and characterized the reverse transcriptase (RT)-coding sequences of Rex1 elements of five species of this genus.


The amino acid sequences deduced from the nucleotide sequences of the isolated fragments allowed us to unambiguously identify regions corresponding to domains 3–7 of RT. Some of the nucleotide sequences isolated from Physlaemus ephippifer and P. albonotatus had internal deletions, suggesting that these fragments are likely not active TEs, despite being derived from a Rex1 element. When hybridized with metaphase chromosomes, Rex1 probes were revealed at the pericentromeric heterochromatic region of the short arm of chromosome 3 of the P. ephippifer karyotype. Neither other heterochromatin sites of the P. ephippifer karyotype nor any chromosomal regions of the karyotypes of P. albonotatus, P. spiniger and P. albifrons were detected with these probes.


Rex1 elements were found in the genomes of five species of Physalaemus but clustered in only the P. ephippifer karyotype, in contrast to observations in some species of fish, where large chromosomal sites with Rex1 elements are typically present.


Repetitive DNAin situ hybridizationChromosomeRetrotransposonLeptodactylidae


Eukaryotic genomes contain large amounts of repetitive DNA sequences, many of which are interspersed repeats derived from transposable elements (TEs) (reviewed in [13]). With the ability to integrate and occupy a large portion of the eukaryotic genome, TEs greatly influence genomic architecture (reviewed in [1, 4]). TEs are also involved in karyotype evolution because these mobile sequences can induce chromosomal rearrangements, including deletions, duplications, inversions and translocations (reviewed in [1, 5]). Therefore, the identification of this type of repetitive sequence may be valuable for evolutionary cytogenetic studies.

TE sequences are grouped in two large families, class I elements (retrotransposons) and class II elements (transposons), which are characterized by the intermediate molecule used in the transposition process. Class I elements have an RNA molecule as an intermediary for transposition, while class II elements move in the genome using DNA copies as intermediates or without any intermediate [2, 6, 7]. The eukaryotic transposons are further classified as “cut-and-paste” transposons, Helitrons and Politrons, which are, respectively, non-replicative, rolling-circle replicative and self-synthesizing (reviewed in [2, 3]). Among the eukaryotic retrotransposon, two principal groups are recognized, according to the presence or absence of long terminal repeats (LTR) flanking their open ready frames (ORFs): the LTR retrotransposons and the non-LTR retrotransposons, also known as LINEs (long interspersed nucleotide element). Additionally, Penelope and DIRS (Dictyostelium intermediate repeat sequence) retrotransposons have been identified (reviewed in [2]).

The retrotransposons families Rex (Retroelement of Xiphophorus) 1, Rex2, Rex3 and Rex6 are non-LTR retrotransposons, and they were first isolated from the fish genus Xiphophorus [810]. The Rex1 element encodes a reverse transcriptase and an apurinic/apyrimidinic endonuclease, which is frequently lost [9]. The 3′ untranslated region of several Rex1 elements is followed by tandem repeat oligonucleotides that are variable in length (5–7 nt) and sequence. Based on an analysis of RT amino acid sequence, Volff and colleagues [9] reasoned that the Rex1 sequences and Babar elements (for Battrachocottus baikalensis retrotransposon) cannot be assigned to any other known family of TE and suggested a moderately close relationship between Rex1/Babar elements and members of the CR1 family of non-LTR retrotransposons.

The Rex family is widespread in fishes and was already mapped to a number of fish karyotypes through in situ hybridization, providing valuable markers for karyotype comparisons (examples in [820]; for review, see [21]). For Anura, the only available reports on Rex sequences arose from studies not designed specifically for the analysis of this TE but rather from the sequencing of the whole genomes of the pipid Xenopus tropicalis [22, 23] and the dicroglossid Nanorana parkeri [24; GenBank accession number: JYOU00000000.1], which are representatives of the non-neobatrachian and Ranoidea, respectively. In addition, in contrast to fish, the karyotype organization of this or any other TE has not been explored using cytogenetic studies.

In this study, we aimed to evaluate i) whether Rex1 is also present in Hyloidea, the Anuran superfamily that, together with Ranoidea, composes Neobatrachia and ii) whether Rex1 sequences are sufficiently clustered in Anuran genomes to be used as chromosomal markers in Anuran cytogenetics. To assess these goals, we elected the leptodactylid genus Physalaemus, which comprises 46 species [25] that are currently arranged in two major clades: the P. cuvieri Clade with six species groups (P. biligonigerus group, P. cuvieri group, P. gracilis group, P. henselii group, P. olfersii group) and the P. signifer Clade [26]. Twenty of the species of Physalaemus have already been karyotyped [2737], and the results show 2n = 22. Physalaemus is attractive for cytogenetic and genomic studies, particularly because of the high interspecific variation in the number and/or distribution of nucleolus organizer regions (NOR) [29, 30, 3237]) and because heteromorphic sex chromosomes are only recognized in P. ephippifer [34]. We searched for sequences related to the Rex1 family in five species belonging to different species groups of Physalaemus and used the isolated sequences as probes for in situ hybridization assays.


Rex1 sequences of Physalaemus species

We obtained 23 clones containing fragments of Rex1 isolated from genomic DNA of Physalaemus ephippifer, 18 from P. albifrons, 16 from P. albonotatus and one from Physalaemus aff. cuvieri. One sequence of P. henselii and one of P. spiniger were isolated and sequenced directly without cloning.

Among the 16 fragments isolated from Physalaemus albonotatus, three types of sequences were found, which differed in nucleotide sequence and size. In the 339 bp sequence isolated from the P. albonotatus genome (Pab-Rex1C12), a 221 bp segment (positions 190–410 in Fig. 1) is missing, which was present in all of the remaining sequences isolated from the Physalaemus species. The first 190 bp and the last 160 bp of this sequence were highly similar to the corresponding regions of the other isolated sequences (Fig. 1). A codon analysis of this truncated sequence of P. albonotatus revealed an in-frame stop codon at the beginning of the isolated sequence (at positions 85–87 as shown in Fig. 1). The other two sequences isolated from P. albonotatus were 86 % similar to each other and were 547 bp and 571 bp in length. One segment with 6 nucleotides and another with 17 nucleotides that were present in the 571 bp fragments were absent in the 547 bp sequence (segments from positions 269–274 and from positions 421–437 as shown in Fig. 1). Two sequences that were 95 % similar to each other were also recognized among the fragments isolated from P. ephippifer (Fig. 1).
Figure 1
Fig. 1

Alignment of the Rex1 fragments isolated from species of Physalaemus with corresponding sequences available in GenBank. The sequences P. ephippifer Pep-Rex1C11P3, P. ephippifer Pep-Rex1C12P3 and P. ephippifer Pep-Rex1C13P3 were obtained from the microdissected 3p per band. The primers used to isolate the sequences are shaded in gray at the ends of the sequences. Black areas indicate identical sites, while variable sites are colored white. Premature stop codons are shown in blue. U18939.1 is the GenBank accession number of a Babar sequence (a Rex1-related element) of Battrachocottus baikalensis. AJ288466.1, AJ288450.1, AJ288444.1, and AJ288462.1 are GenBank accession numbers of retroelement Rex1 sequences isolated from Anguilla japonica (AJ288466.1) or Xiphophorus helleri

The Rex1 fragments isolated from all the Physalaemus species, except for the 339 bp sequence of P. albonotatus, were very similar to each other (average similarity = 92 %) and were 68 and 73 % similar to the Rex1/Babar sequences already described for Anguilla japonica and Battrachocottus baikalensis, respectively (Fig. 1). We note that the sequence isolated from Physalaemus aff. cuvieri differed significantly at positions 29–52 with regard to the other sequences of Physalaemus (Fig. 1). When the Rex1 sequences of Physalaemus (except for the 339 bp sequence of P. albonotatus) were compared with the sequence REX1-5_XT, which was obtained from the anuran Xenopus tropicalis and previously recognized as Rex1 [22, 23] (sequence available at Repbase database, lower similarity values were found (from 54 to 58 %) (Additional file 1). Comparison of the Rex1 sequences isolated from Physalaemus with the element CR1 of Gallus gallus, which Volff and colleagues consider to be distantly related to Rex1/Babar elements [9], showed no similarity (Additional file 1).

Amino acid sequence translation of all fragments of Rex1 (Fig. 2) allowed us to clearly identify the regions corresponding to the conserved domains 3 to 7 of the RT, as identified by Malik and colleagues [37] and Volff and colleagues [8, 9]. When compared to Battrachocottus baikalensis (GenBank accession number U18939.1) and Anguilla japonica (GenBank accession numbers AJ288466.1) sequences, the Rex1 sequences isolated from Physalaemus ephippifer, P. albifrons, P. henselli, P. spiniger, P. albonotatus and P. aff. cuvieri from Alenquer–PA failed to show an AAC nucleotide triplet at positions 416–418 of the sequences shown in Fig. 1, as well as of the sequences isolated from Xiphophorus helleri [9] (GenBank accession numbers AJ288450.1, AJ288444.1 and AJ288442.1). The absence of this ACC triplet potentially affects the translation of two codons. In addition, deletions of one or two nucleotides could be detected in the fragments Pep-Rex1C1, Pep-Rex1C17 and Pep- Rex1C19 of P. ephippifer after comparing these sequences to the others (Fig. 1).
Figure 2
Fig. 2

Amino acid sequence inferred from the nucleotide sequences shown in Fig. 1. Black sites are conserved amino acids. Bars indicate domains 3–7 of the Rex1 RT as determined by Volff and colleagues [8, 9] and Malik and colleagues [37]. Asterisks represent premature stop codons

Mapping of Rex1 sequences on metaphase chromosomes

When used as probes and mapped to metaphase chromosomes, the Rex1 sequences did not reveal any chromosomal sites at all (not even small dots) in the karyotypes of Physalaemus albonotatus, P. albifrons, P. aff. cuvieri or P. spiniger. In contrast, the probe Pep-Rex1C17 localized to the pericentromeric region of the short arm of chromosome pair 3 (3p per) of P. ephippifer (Fig. 3), suggesting accumulation of Rex1 sequences at this heterochromatic chromosomal region (Fig. 3 – inset). No hybridization signal was observed at any other site of this karyotype (Fig. 3), not even at regions previously revealed to be heterochromatic by Nascimento and colleagues [34]. The region at 3p per also hybridized with type I 5S ribosomal DNA (5S rDNA), as previously reported by Nascimento and colleagues [34].
Figure 3
Fig. 3

Chromosome localization of the Pep-RexC17 sequence in the Physalaemus ephippifer karyotype. Note the hybridization signal in chromosome pair 3. The FITC-signals are shown in red for better visualization. The C-banded pair in the inset shows the band that coincides with the site detected by the Rex1 probe and was thus microdissected for the isolation of some of the Rex1 sequences shown in Fig. 1. Bar = 1 μm

Rex1 and 5S rDNA sequences isolated from microdissected 3p per of P. ephippifer

Polymerase chain reaction (PCR) using primers for Rex1 sequences resulted in the isolation of ~550-bp fragments from the microdissected 3p per band of the Physalaemus ephippifer karyotype, and three of these fragments were cloned and sequenced. Two cloned fragments were 547 bp (P. ephippifer Pep-Rex1C11P3 and P. ephippifer Pep-Rex1C12P3 in Fig. 1), and one was 554 bp (P. ephippifer Pep-Rex1C13P3 in Fig. 1). All of these fragments were very similar to the major Rex1 sequences isolated from genomic DNA of Physalaemus species (Fig. 1). The 547-bp fragments and the sequence Pab-Rex1C6 of P. albonotatus had a deletion of two segments compared to the other sequences (from position 269 to position 274, and from position 421 to position 437 in Fig. 1).

PCR using primers for 5S rDNA resulted in the amplification of ~300-bp fragments from the microdissected 3p per band. Their nucleotide sequencing proved the presence of the 5S rRNA gene in this chromosome band (Fig. 4).
Figure 4
Fig. 4

Analysis of the 5S rDNA of the 3p per band of the Physalaemus ephippifer karyotype. a Annealing sites of the primers used for the analysis of the 5S rDNA (for details, see Methods section). NTS: non-transcribed spacer. b Alignment of the nucleotide sequence of a fragment of the 5S rRNA gene isolated from the 3p per band of the Physalaemus ephippifer karyotype with the type I and type II 5S rRNA gene of Physalaemus cuvieri (GenBank accession numbers: JF281131 and JF281133, respectively). The site positions were numbered according to the scheme shown in a


The results described here suggest that the elements we isolated from the genus Physalaemus might represent part of the retroelement Rex1, or at least sequences derived from it. We have formed this hypothesize because the elements’ nucleotide sequences and presumed amino acid sequences are highly similar to the previously described RT coding region sequences of Rex1, especially those from Anguilla japonica [9] and Battrachocottus baikalensis (GenBank accession number U18939.1 – see comment in Volff and colleagues [9]). Although Volff and colleagues [9] affirm that Rex1/Babar elements are somewhat related to the CR1 element isolated from Gallus gallus, we could not detect any similarity between this element and the sequences isolated from species of Physalaemus.

The nucleotide sequences isolated from chromosome 3 of Physalaemus ephippifer and two of the three fragments isolated from P. albonotatus were similar to the RT-coding sequences of the Rex1 elements; however, these sequences have deletions that may affect their presumed reading frame. For the sequence Pab-Rex1C12 of P. albonotatus, a premature stop codon was also detected. It is likely, therefore, that these sequences are no longer active retroelements. Interestingly, the truncated sequences isolated from P. ephippifer were isolated from the heterochromatic block at 3p per, and this chromosomal region was detected using Rex1 probes in fluorescence in situ hybridization (FISH) assays. It is therefore reasonable to suggest that the loss of transposition ability may be related to mechanisms of accumulation of Rex1-derived sequences in this heterochromatic region. The accumulation of TEs in heterochromatin has been reported and discussed by some authors [4, 19, 3841]. Charlesworth & Langley [38] report that the suppression of heterochromatin crossing-over and gene inactivity are two factors that influence the preferential distribution of transposable sequences in such regions of the genome. For P. ephippifer, the molecular mechanisms involved in Rex1-derived sequences in 3p per were not investigated, but co-localization with 5S rDNA in FISH assays was an intriguing finding.

The association between TEs and rDNA sequences was already reported for many organisms. In arthropods, for example, R1 and R2 retrotransposable elements are components of the major rDNA [42, 43]. In the fish Erythrinus erythrinus, sequences belonging to the Rex3 family were mapped at 5S rDNA sites and proposed to be involved in the spreading of 5S rDNA sequences in the genomes of some karyomorphs [43]. No evidence that supports the involvement of Rex1 sequences in spreading of 5S rDNA in Physalaemus or any other anuran is available to date. The molecular nature of the association between these sequences (whether they are interspersed or form independent clusters that are sufficiently close to co-locate in FISH assays) as well as the evolutionary implications of this association are open questions for future studies.

Although in situ hybridization revealed a cluster of Rex1 sequences at the heterochromatic band in the short arm of chromosome 3 of Physalaemus ephippifer, no other heterochromatic site in the karyotype of this species was detected by Rex1 probes in FISH experiments. Rex1 probes were unable to detect any chromosomal site in the karyotypes of P. albonotatus, P. spiniger, or P. albifrons. These findings diverge from those found for several species of fish, in which Rex1, Rex3 and Rex6 elements have been mapped to several heterochromatin sites [13, 14, 16, 19]. The FISH experiments suggest that in Physalaemus species, Rex1 sequences are less abundant than those found for fish species. It is noteworthy that in the genome of anuran Xenopus (Silurana) tropicalis, non-LTR retrotransposons, including Rex1, CR1 and L2 elements, are estimated to correspond to only 0.6 % of the genome [23].


Our findings show that the Rex1 family of retrotransposons is not restricted to Xenopus tropicalis and Nanorana parkeri but is also present in the leptodactylid genus Physalaemus. The occurrence of these TEs both in two basal lineages of Anura (i.e., pipids and dicroglossids) and in a derived genus of Neobatrachia (i.e., Physalaemus) suggests that this element could be largely distributed in anuran genomes. Although Rex1 sequences were not highly clustered in the Physalaemus karyotypes, which differed from observations in fish species, we provided evidence for the accumulation of Rex1 sequences in a heterochromatin site of the karyotype of P. ephippifer that associated with 5S rDNA sequences. Our results shed new light for further investigation into the evolutionary dynamics of both types of sequences in anuran genomes.



Individuals were used that belonged to the two major clades of Physalaemus (i.e., P. cuvieri Clade and P. signifer Clade [26]). Samples of liver and muscle of P. albonotatus (P. cuvieri group), P. albifrons (P. cuvieri group), P. aff. cuvieri (P. cuvieri group), P. ephippifer (P. cuvieri group), P. spiniger (P. signifer Clade) and P. henselii (P. henselii group of the P. cuvieri Clade) were obtained from the tissue collection deposited at the Laboratory of Chromosomal Studies, at the Department of Structural and Functional Biology of the Institute of Biology, at the University of Campinas (UNICAMP) (Table 1). Metaphase chromosome preparations of P. ephippifer individuals from Belém-PA (ZUEC 13734♂; ZUEC 13740♂, ZUEC13741♀ and ZUEC 13705♂) were obtained from cell suspensions available at the same laboratory, previously obtained by Nascimento and colleagues [34]. The experiments were approved by the ethics committee CIBio/IB-UNICAMP (#2005/03).
Table 1

Identification, voucher number and locality of the specimens used for the isolation of the Rex1 fragments


Specimen voucher


Physalaemus albifrons (P. cuvieri group)

ZUEC 12361

Vassouras, Barreirinhas-MA, Brazil

Physalaemus albonotatus (P. cuvieri group)

ZUEC 16419

Lambari do Oeste-MT, Brazil

Physalaemus ephippifer (P. cuvieri group)

ZUEC 13705

Belém-PA, Brazil

Physalaemus aff. cuvieri (P. cuvieri group)

ZUEC 18191

Alenquer-PA, Brazil

Physalaemus henselii (P. henselii group)

MHNM 9512

Ruta 5, km 492, Pueblo Madera, Rivera, Uruguay

Physalaemus spiniger (P. signifer Clade)

ZUEC 14516

Reserva Salto Morato-Curitiba-PR, Brazil

ZUEC: Museu de Zoologia “Prof. Adão José Cardoso”, Universidade Estadual de Campinas (UNICAMP), Campinas, São Paulo, Brasil. MNHN: Museo Nacional de Historia Natural de Montevideo. Uruguay. PA: State of Pará; MT: State of Mato Grosso; MA: State of Maranhão; PR: State of Paraná

Isolation of partial sequence of the retrotransposon Rex1 from genomic DNA

Samples of genomic DNA were isolated according to a procedure previously reported by Medeiros and colleagues [44] and subjected to PCR to isolate Rex1 sequences. PCR assays were performed using the primers RTX1-F1 (TTCTCCAGTGCCTTCAACACC) and RTX1-R3 (TCCCTCAGCAGAAAGAGTCTGCTC) [9], which are specific for isolating a region of the gene encoding the RT (ORF 2) of the TE Rex1. The products of these reactions were analyzed after electrophoresis in a 1 % agarose gel. Bands corresponding to fragments of approximately 550 bp were observed in each case. For Physalaemus albonotatus, an additional band of fragments of approximately 350 bp was obtained. All of these bands were cut from the gel with sterile blades, and the DNA fragments were purified with the GFX PCR and Gel Band DNA Purification kit (GE Healthcare).

Cloning of fragments of the retrotransposon Rex1 isolated from genomic DNA

The Rex1 fragments amplified as described above were each inserted into the plasmid vector pGEM-T (Promega), following the manufacturer’s instructions. The recombinant vectors were used to transform JM109 Escherichia coli competent cells using the cloning kit Transformaid Bacterial Transformation (Fermentas), following the manufacturer’s directions. The positive clones were selected and used for extraction of plasmids, according to the mini-prep method described by Sambrook and colleagues [45]. For amplification of the inserts, samples of the isolated plasmids were used in PCR with T7 and SP6 universal primers. After purification with the GFX PCR and Gel Band DNA Purification kit (GE Healthcare), samples of the amplified inserts were sequenced using the BigDye Terminator kit (Applied Biosystems), according to the manufacturer’s instructions. The sequences obtained were edited using BioEdit software [46], and compared to sequences available at the GenBank and Repbase databases. For comparison to sequences in the Repbase database, we used the CENSOR engine with default parameters, searching within the Xenopus (Silurana) tropicalis collection for Rex1.

Metaphase chromosome analyses

To obtain metaphase chromosome preparations of Physalaemus ephippifer (ZUEC 13740 and ZUEC 13741), cell suspensions available at the Laboratory of Chromosomal Studies, at the Department of Structural and Functional Biology of the Institute of Biology, at the University of Campinas (UNICAMP) were dropped onto clean slides. Cloned Rex1 fragments generated from genomic DNA of Physalaemus species were labeled with dUTP-biotin (Roche®) by PCR and in situ hybridized to the karyotypes. The hybridization protocol [47] used an anti-biotin antibody (Vector) and a fluorescein isothiocyanate (FITC)-conjugated secondary antibody (Vector). The chromosomes were stained with DAPI (0.5 μg/mL).

Isolation of Rex1 and 5S rDNA sequences from the microdissected 3p per band of Physalaemus ephippifer

To demonstrate that Rex1 sequences are present in the pericentromeric C-band of the short arm of chromosome 3 of Physalaemus ephippifer (as suggested by FISH - see Results for details), which also bears 5S rDNA (as reported previously [34]), we isolated Rex1 and 5S rDNA sequences from the microdissected 3p per band by PCR. For microdissection, cell suspensions of the P. ephippifer specimen ZUEC 13734 were dropped onto a membrane strip containing polyethylene-naphthalate (PEN) that was previously exposed to UV and incubated at −20 °C for 30 min. The material was subjected to C-banding according to a previously reported procedure [48]. The best metaphase examples were used for UV laser-microdissection of 18 copies of the heterochromatic pericentromeric region of the short arm of chromosome 3 of P. ephippifer with the MicroBeam 4.1 system (Zeiss). The cuts in the PEN membrane were made with UV at 0.5–0.6 μJ/pulse, and isolated regions were catapulted using a pulse of 0.2 μJ to the lid of a microtube containing 9 μL of TE buffer. The collected material was maintained in TE for at least 16 h and then subjected to PCR using the primers RTX1-F1 and RTX1-R3 [9] for the amplification of Rex1 sequences and the primers 5S-A (TACGCCCGATCTCGTCCGATC) and 5S-B (5′-CAGGCTGGTATGGCCGTAAGC-3′) [49] for the amplification of 5S rDNA sequences. The amplified Rex1 fragments were cloned and sequenced as described above. Two rounds of PCR with the primers 5S-A and 5S-B were performed, and the amplified 5S rDNA fragments were directly sequenced using the primers 5S-A [49] and 5S120T1-R (AGCTTACAGCACCTGGTATTC) [50] (see the annealing sites of the primers in Fig. 4) and the BigDye Terminator kit (Applied Biosystems), according to the manufacturer’s instructions.

To ensure that the microdissected regions correspond to the 3p per band, we used the captured DNA as probes in FISH assays. Therefore, the microdissected material was first amplified using GenomePlex Single Cell WGA4 (Sigma-Aldrich) and labeled with dUTP-biotin (Roche®) using GenomePlex Single Cell WGA3 (Sigma-Aldrich) (Fig. 5). The hybridization and probe detection protocols were the same as used with the Rex1 probes (reported above).
Figure 5
Fig. 5

In situ hybridization of a probe generated from the microdissection of the 3p per band of the karyotype of Physalaemus ephippifer. a DAPI image. b Merged DAPI and FISH images. Only the 3p per band (arrows) was detected



We thank the São Paulo Research Foundation (FAPESP) #2011/09239-0, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenadoria de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/PROAP). We also thank Dr. Daniel Pacheco Bruschi for isolating and sequencing the Rex1 fragment of Physalaemus sp. from Alenquer-PA, Brazil.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Departamento de Biologia Estrutural e Funcional, Instituto de Biologia, Universidade Estadual de Campinas, São Paulo, Brazil
Laboratorio de Genética Evolutiva, Instituto de Biología Subtropical (CONICET-UNaM), Facultad de Ciencias Exactas Químicas y Naturales, Universidad Nacional de Misiones, Posadas, Argentina


  1. Frechotte C, Pritham JE. DNA transposons and evolution of eukaryotic genomics. Annu Rev Genet. 2007;41:331–69.View ArticleGoogle Scholar
  2. Jurka J, Kapitonov VV, Kohany O, Jurka VM. Repetitive sequences in complex genomes: structure and evolution. Annu Rev Genomics Hum Genet. 2007;8:241–59.View ArticlePubMedGoogle Scholar
  3. Muñoz-López M, García-Pérez JL. DNA transposon: nature and application in genome. Curr Genomics. 2010;11:115–28.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Kidwell MG. Transposable elements and the evolution of genome size in eukaryotes. Genetica. 2002;115:49–63.View ArticlePubMedGoogle Scholar
  5. González J, Petrov DA. Evolution of genome content: population dynamics of transposable elements in flies and humans. Methods Mol Biol. 2012;855:361–83.View ArticlePubMedGoogle Scholar
  6. Wicker T, Sabot F, Hua-van A, Bennetzen JL, Capy P, Chalhoub B, et al. A unified classification system for eukaryotic transposable elements. Nat Rev Genet. 2007;8:973–82.Google Scholar
  7. Kapitonov VV, Jurka J. A universal classification of eukaryotic transposable elements implemented in Repbase. Nat Rev Genet. 2008;9:411–2. author reply 414.View ArticlePubMedGoogle Scholar
  8. Volff JN, Körting C, Sweeney K, Schartl M. The non-LTR retrotransposon Rex3 from the fish Xiphophorus is widespread among teleosts. Mol Biol Evol. 1999;16:1427–38.View ArticlePubMedGoogle Scholar
  9. Volff JN, Körting C, Schartl M. Multiple lineages of the non-LTR retrotransposon Rex1 with varying success in invading fish genomes. Mol Biol Evol. 2000;17:1684–4.Google Scholar
  10. Volff JN, Körting C, Froschauer A, Sweeney K, Schartl M. Non-LTR retrotransposon encoding a restriction enzyme-like endonuclease in vertebrates. J Mol Evol. 2001;52:351–60.PubMedGoogle Scholar
  11. Volff JN, Körting C, Meyer A, Schartl M. Evolution and discontinuous distribution of Rex3 retrotransposons in fish. Mol Biol Evol. 2001;18:427–31.View ArticlePubMedGoogle Scholar
  12. Dasilva C, Hadji H, Ozouf-Costaz C, Nicaud S, Jaillon O. Remarkable compartmentalization of transposable elements and pseudogenes in the heterochromatin of the Tetraodon nigroviridis genome. Proc Natl Acad Sci. 2002;99:13636–41.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Bouneau L, Fischer C, Ozouf-Costaz C, Froschauer A, Jailon O, Coutanceu JP, et al. An active Non-LTR retrotransposon with tamdem struture in the compact genome of the pufferfish Tetraodon nigroviridis. Genome Res. 2003;13:1686–95.Google Scholar
  14. Ozouf-Costaz C, Brandt J, Körting C, Pisano E, Bonillo C, Coutanceau JP, et al. Genomes dynamics and chromosomal localization of the non-LTR retrotransposon Rex1 and Rex3 in Antartic fish. Antart Sci. 2004;16:51–7.Google Scholar
  15. Gross MC, Schneider CH, Valente GT, Porto JIR, Martins C, Feldberg E. Comparative cytogenetic analysis of the genus of Symphysodon (discus fishes, Cichlidae): chromosomal characteristics of retrotransposons and minor ribosomal DNA. Cytogenet Genome Res. 2009;127:43–53.View ArticlePubMedGoogle Scholar
  16. Teixeira WG, Ferreira IA, Cabral-de-Mello DC, Mazzuchelli V, Pinhal GT, Poletto DAB, et al. Organization of the repeated DNA elements in the genome of the cichlid fish Cichla kelberi and its contributions to knowledge of fish genomes. Cytogenet Genome Res. 2009;125:224–34.Google Scholar
  17. Mazzuchelli J, Martins C. Genomic organization of repetitive DNAs in the cichlid fish Astronotus ocellatus. Genetica. 2009;136:461–9.View ArticlePubMedGoogle Scholar
  18. Valente GT, Mazzucheli J, Ferreira IA, Poletto AB, Fantinatti BEA, Martins C. Cytogenetic mapping of retroelement Rex1, Rex3 and Rex6 among cichlid fish: new insights on the chromosomal distribution of transposable elements. Cytogenet Genome Res. 2011;133:34–42.View ArticlePubMedGoogle Scholar
  19. Schneider CH, Gross MC, Terencio ML, Do Carmo EJ, Martins C, Feldberg E. Evolutionary dynamics of retrotransposable elements Rex1, Rex3 and Rex6 in neotropical cichlid genomes. BMC Evol Biol. 2013;13:152.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Voltolin TP, Mendoça BB, Ferreira DC, Senhorini JA, Foresti F, Porto-Foresti F. Chromosomal localization Rex1 in the genome in five Prochilodus (Teleostei: Characiformes: Prochilodontidae) species. Mob Genet Elements. 2013;3:e25846.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Ferreira DC, Porto-Foresti F, Oliveira C, Foresti F. Transposable elements as potential source for understanding the fish genome. Mob Genet Elements. 2011;1:112–7.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Kapitonov VV, Jurka J. A family of Rex1 non-LTR retrotransposons from frogs – a consensus. Repbase Rep. 2009;9:1564–72.Google Scholar
  23. Hellsten U, Harland RM, Gilchrist MJ, Hendrix D, Jurka J, Kapitonov V, et al. The genome of the Western clawed frog Xenopus tropicalis. Science. 2010;328:633–6.Google Scholar
  24. Sun YB, Xiong ZJ, Xiang XY, Liu SP, Zhou WW, Tu XL, et al. Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes. Proc Natl Acad Sci USA. 2015;2:E1257–1262.Google Scholar
  25. Frost DR: Amphibian species of the world: an online reference. Version 6. 2015. Database accessible at American Museum of Natural History, New York, USA.
  26. Lourenço LB, Targueta CP, Baldo D, Nascimento J, Garcia PCA, Andrade GA, et al. Phylogeny of Physalaemus (Anura, Leptodactylidae) inferred from mitochondrial and nuclear gene sequences. Mol Phylogenet Evol. 2015;92:204–16.Google Scholar
  27. Beçak ML, Denaro L, Beçak W. Polyploidy and mechanisms of karyotypic diversification in Amphibia. Cytogenetics. 1970;9:225–38.View ArticlePubMedGoogle Scholar
  28. De Lucca EJ. Chromosomal studies in twelve species of Leptodactylidae and one Brachycephalidae. Caryologia. 1974;27:183–91.View ArticleGoogle Scholar
  29. Amaral MJLV, Cardoso AJ, Recco-Pimentel SM. Cytogenetic analysis of three Physalaemus species (Amphibia, Anura). Caryologia. 2000;53:283–8.View ArticleGoogle Scholar
  30. Silva APZ, Baldissera FA. Karyotypes and nucleolus organizer regions in four species of the genus Physalaemus (Anura, Leptodactylidae). Iheringia Ser Zool. 2000;88:159–64.Google Scholar
  31. Quinderé YRSD, Lourenço LB, Andrade GV, Tomatis C, Baldo D, Recco-Pimentel SM. Polytypic and polymorphic cytogenetic variations in the widespread anuran Physalaemus cuvieri (Anura, Leiuperidae) with emphasis on nucleolar organizing regions. Biol Res. 2009;42:79–92.View ArticlePubMedGoogle Scholar
  32. Vittorazzi SE, Quinderé YRSD, Recco-Pimentel SM, Tomatis C, Baldo D, Lima JRF, et al. Comparative cytogenetics of Physalaemus albifrons and Physalaemus cuvieri species groups (Anura, Leptodactylidae). Comp Cytogenet. 2014;8:103–23.Google Scholar
  33. Milani M, Cassini CS, Recco-Pimentel SM, Lourenço LB. Karyotypic data detect interpopulational variation in Physalemus olfersii and in first case of supernumerary chromosome in the genus. Anim Biol J. 2011;2:21–8.Google Scholar
  34. Nascimento J, Quinderé YRSD, Recco-Pimentel SM, Lima JRF, Lourenço LB. Heterorphic Z and W sex chromosomes in Physalaemus ephippifer (Steindachner, 1864) (Anura, Leiuperidae). Genetica. 2010;138:1127–32.View ArticlePubMedGoogle Scholar
  35. Tomatis C, Baldo D, Kolenc F, Borteiro C. Chromosomal variation in the species of the Physalaemus henselii Group (Anura: Leiuperidae). J Herpetol. 2009;43:555–60.View ArticleGoogle Scholar
  36. Provete DB, Garey MV, Toledo LF, Nascimento J, Lourenço LB, Rossa-Feres DC, et al. Redescription of Physalaemus barrioi Bokermann, 1966 (Anura: Leiuperidae). Copeia. 2013;3:507–18.Google Scholar
  37. Malik HS, Burke WD, Eickbush TH. The age and evolution of non-LTR retrotransposable elements. Mol Biol Evol. 1999;6:793–805.View ArticleGoogle Scholar
  38. Charlesworth B, Langley CH. The population genetics of Drosophila transposable elements. Annu Rev Genet. 1989;23:251–87.View ArticlePubMedGoogle Scholar
  39. Dimitri P, Junakovic N. Revising the selfish DNA hypothesis: new evidence on accumulation of transposable elements in heterochromatin. Trends Genet. 1999;15:123–4.Google Scholar
  40. Hua-Van A, LeRouzic A, Tribaud SB, Filée J, Capy P. The struggle for life of genome’s selfish architects. Biol Direct. 2011;6:19.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Jakubczak JL, Burke WD, Eickbush TH. Retrotransposable elements R1 and R2 interrupt the rRNA genes of most insects. Proc Natl Acad Sci. 1991;88:3295–9.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Zhang X, Eickbush MT, Eickbush TH. Role of recombination in the long-term retention of transposable elements in rRNA gene loci. Genetics. 2008;180:1617–26.PubMed CentralView ArticlePubMedGoogle Scholar
  43. Cioffi MB, Martins C, Bertollo LAC. Chromosome spreading of associated transposable elements and ribosomal DNA in the fish Erythrinus erythrinus. Implications for genome change and karyotype evolution in fish. BMC Evol Biol. 2010;10:271.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Medeiros LR, Lourenço LB, Rossa-Feres DC, Lima AL, Andrade GV, Giaretta AA, et al. Comparative cytogenetic analysis of some species of the Dendropsophus microcephalus group (Anura, Hylidae) in the light of phylogenetic inferences. BMC Genet. 2013;14:59.Google Scholar
  45. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Press; 1989.Google Scholar
  46. Hall TA. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–8.Google Scholar
  47. Viegas-Péquignot E. In situ hybridization to chromosomes with biotinylated probes. In: Willernson D, editor. In Situ Hybridization: A Practical Approach. Oxford: IRL Press; 1992. p. 137–58.Google Scholar
  48. King M. C-banding studies on Australian hylid frogs: secondary constriction structure and the concept of euchromatin transformation. Chromosoma. 1980;80:191–217.View ArticleGoogle Scholar
  49. Pendás AM, Morán P, Freije JP, Garcia-Vázquez E. Chromosomal mapping and nucleotide sequence of two tandem repeats of Atlantic salmon 5S rDNA. Cytogenet Cell Genet. 1994;67:31–6.View ArticlePubMedGoogle Scholar
  50. Rodrigues DS, Rivera M, Lourenço LB. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae). BMC Genet. 2012;13:17.Google Scholar


© Nascimento et al. 2015
