Open Access

Long-term follow-up of females with unbalanced X;Y translocations—reproductive and nonreproductive consequences

  • Whitney A Dobek1,
  • Hyung-Goo Kim1, 2,
  • Cedric A Walls1,
  • Lynn P Chorich1, 2,
  • Sandra PT Tho1, 2,
  • Zi-Xuan Wang3,
  • Paul G McDonough1, 2 and
  • Lawrence C Layman1, 2, 4Email author
Molecular Cytogenetics20158:13

https://doi.org/10.1186/s13039-015-0112-0

Received: 2 December 2014

Accepted: 19 January 2015

Published: 22 February 2015

Abstract

Background

Females with Xp;Yq translocations manifest short stature and normal fertility, but rarely have follow-up. The study purpose was to define the phenotype of a family with t(X;Y)(p22.3;q11.2), determine long-term reproductive function, and compare to all reported female cases.

Methods

Comprehensive clinical and molecular analyses were performed on the female proband, who had regular menses, normal endocrine function, and three pregnancies spanning seven years--a normal liveborn male and two with unbalanced translocations (liveborn female and stillborn male).

Results

The translocation truncated KAL1 and deleted 44 genes on der(X). Our report constitutes the longest follow-up of an X;Y translocation female. She had no evidence of Kallmann syndrome, gonadoblastoma, or cardiovascular disease. Detailed analysis of 50 published female cases indicated a uniform lack of follow-up and significant morbidity—intellectual disability (10%), facial dysmorphism (28%), eye abnormalities (14%), and skeletal defects (28%).

Conclusions

Our findings indicate normal ovarian function to date in a woman with an t(X;Y)(p22.3;q11.2). However, additional published studies in the literature suggest careful follow-up is necessary and contradict the generalization that females with Xp;Yq translocations are usually normal except for short stature.

Keywords

X;Y translocation Xp22 deletion Chromosome translocation Short stature SHOX gene Kallmann syndrome KAL1 gene

Background

Translocations involving the X and Y chromosome may affect reproductive function. They occur because of pairing of homologous sequences of the pseudoautosomal regions of Xp and Yq in paternal meiosis [1]. These translocations are relatively rare in humans, but when they occur, they usually involve cytogenetic breakpoints at Xp22 and Yq11 [2]. The phenotype of affected individuals varies depending upon the number and specific genes deleted from the X chromosome. Affected males may present as stillborns or liveborn males with multiple congenital anomalies depending upon the number of X chromosomal genes that are deleted [2]. In contrast, females with X;Y translocations are usually reported to be short with normal intelligence and normal reproductive function, but some may have mild intellectual disability [2].

More than 50 X;Y translocation patients with breakpoints at Xp22 and Yq11 have been reported [2-20], but there are still many uncertainties regarding the specific molecular breakpoints involved, the phenotype of males and females, their long-term reproductive potential, and the risk of gonadal tumor formation. An extensive review of the literature indicates that of the reported female cases, follow-up was only rarely reported and that the phenotype is perhaps more severe than often stated [2-20]. However, there is no comprehensive analysis of the existing female cases to determine the prevalence of the reproductive and nonreproductive phenotypes. We present the clinical and molecular findings in a female proband and her family with an unbalanced X;Y translocation ascertained when her stillborn male was karyotyped. Taking into account this case and a critical evaluation of the literature, the purpose of the present study was to determine: 1) the precise molecular breakpoints of Xp22.31 and Yq11.2; 2) the phenotype of affected males and females; 3) ovarian function and fertility over time in the affected adult female; 4) the risk for cardiac anomalies; 5) the potential for a gonadal tumor in affected females and 6) comparison of this proband with all t(X;Y)(p22)(q11) females reported in the literature to understand the severity of the phenotype for genetic counseling purposes.

Case presentation

At presentation, the proband was a 25-year-old white female G2P1011 with regular menses, who conceived spontaneously without medical intervention (Patient I1 in Figure 1A). Her physical exam was normal except for short stature (4′9″). Her first pregnancy resulted in the birth of a normal, healthy girl (II1) with short stature (<2.5%), but her second pregnancy ended at 20 weeks with the birth of a stillborn male (II2) with hydrocephalus (Figure 1A) who did not have a full autopsy. Of interest, upon second trimester analyte screening, her serum unconjugated estriol was undetectable. Karyotype of the stillborn male II2 revealed 46,Y,der(X)t(X;Y)(p22.3;q11.2). Fluorescent in situ hybridization (FISH) demonstrated ish der(X)t(X;Y)(wcpY+,wcpX+), with the presence of the KAL1 (Kallmann syndrome-1) region and deletion of the STS (steroid sulfatase) locus, narrowing the breakpoint region on Xp22.
Figure 1

The pedigree, karyotype, and genetic map are shown for the patient with the X;Y translocation. (A) The pedigree of the family with unbalanced X;Y chromosome translocations is shown. Quarter shaded circles indicate females with the der(X) who have short stature. II-2 is a stillborn male with the der(X) chromosome. (B) Karyotype of t(X;Y)(p22;Yq11) is shown. The der(X) is indicated by an arrow. (C) The ideogram of the karyotype in the female and corresponding karyotype in the stillborn male. Y chromosome sequences are shown in gray shading. (D) Genetic map documents the 44 genes deleted from this der(X) chromosome. Sequencing of the junction fragment shows that the breakpoint lies within the KAL1 gene in Xp22.3.

Results

The female proband I1 had a complete history and physical exam. Ovarian reserve was assessed using enzyme immunoassays for cycle day #2 serum follicle stimulating hormone (FSH) and random antimullerian hormone (AMH). Since she later presented with infertility, a hysterosalpingogram and preconceptional labs were performed, as was a semen analysis on her male partner.

Both the proband I1 and her prepubertal daughter II1 had an identical unbalanced translocation 46,X,der(X)t(X;Y)(p22.3;q11.23) with the derivative X being deleted of Xp22.3 to the terminus and containing Yq11.2 to the telomere cytogenetically (Figure 1B and C). Interphase FISH studies on the proband’s peripheral lymphocytes demonstrated the presence of the X centromere (DXZ1+) and Yq12 (DYZ1+), but not the Y centromere (DYZ3-), indicating the presence of only Yq11q12 on the derivative (X) chromosome (Figure 1D). SNP arrays revealed that the breakpoint resided within intron 6 of the KAL1 gene (NM_000216.2), indicating that this gene was disrupted and that 44 genes in distal Xp22.3 were deleted (Figure 1E). The junction fragment of the der(X) chromosome was amplified using three sets of primers that could only amplify the X and Y sequences, and these were of the predicted sizes. Nested PCR products generated the expected sized bands (Additional file 1: Figure S1A). These PCR products were then purified and sequenced, and both X and Y-specific sequences were identified. The breakpoint on Xp22.31 is between coordinates of 8,548,685 and 8,548,812 (within 128 bp) and that on Yq11.2 is between coordinates of 15,989,009 and 15,989,287 (within 288 bp) using hg19 of the Human Genome Browser.

However, because of extremely high homology of repeated sequences within these regions of Xp22 and Yq11, the precise breakpoint was not able to be ascertained. Sequenced tagged sites of the Y chromosome indicated the presence of Yq11 sequences in this affected female (Additional file 1: Figure S1B). No centromeric sequences or SRY were identified.

At age 25, proband I1 had a cycle day #2 FSH = 5.9mIU/m L (2.8-11.3, follicular phase) supporting normal ovarian reserve [21]. Because of her extreme short stature and the terminal Xp deletion, she had a cardiac echo to assess her cardiac function and aortic diameter, which was normal. Genetic counseling was provided, which included the 50% risk that males would inherit the der(X) chromosome and likely be stillborn and the 50% risk that female offspring would inherit the translocation and have short stature. The couple elected to attempt conception without intervention, and had a healthy, normal male II3 (presumably 46,XY—but they declined a karyotype).

The proband I1 maintained regular menses, but at age 32, she presented with three years of infertility. Her menses remained regular at 28–29 day intervals; and her physical exam including cardiac and reproductive systems, was normal. Her daughter (II1) remained below the 3% for height and was being evaluated for attention deficit disorder. The parents stated that the daughter was currently receiving one-on-one help in school due to difficulties in reading. During this one year follow-up period, the proband had a cycle day #2 FSH = 2.5mIU (2.8-11.3, follicular phase) and AMH = 5.2 ng/mL (1.1-6.9), two widely utilized tests of ovarian reserve [21]. Cystic fibrosis carrier testing, rubella immunity, thyroid studies, and prolactin were normal. A hysterosalpingogram revealed a bicornuate vs. septate uterus, a patent right tube, and no fill of the left tube (Figure 2). An ultrasound on cycle day 6 showed a normal uterus measuring 5.3 × 4.2 × 2.7 cm with a 3.3 mm (normal) endometrium and normal ovaries—right: 2.8 × 1.9 × 2.4 cm with a 7 mm follicle and 5 other smaller follicles; left: 2.2 × 1.4 × 2.5 cm with 3 small follicles. It was suggested she have ovarian tumor markers—inhibin A, inhibin B, hCG, AFP, and LDH, but these were declined.
Figure 2

Hysterosalpingogram showing a bicornuate vs. septate uterus with a patent right tube indicated by free spill of contrast (indicated by an arrow).

She underwent clomiphene/intrauterine insemination (IUI) for four cycles with a 50 mg dose when there was a follicle on the right. Her estradiols were at appropriate preovulatory levels and ranged from 558–1395 pg/mL on cycle day 10–14 during monitoring (Additional file 1: Table S1) with at least one mature follicle. A serum progesterone performed 8 days after the LH surge was ovulatory. Total motile sperm ranged from 9–11 million for IUIs done on cycle days 12–17. She did not conceive after four cycles, but she continues to have regular menses.

Discussion

Translocations involving the X and Y chromosomes are uncommon, although more than 50 Xp;Yq translocation cases have been reported worldwide [2,22]. In X;Y translocations, the breakpoints typically involve Xp22 and Yq11, which tend to result from pairing of homologous sequences located within these regions [2,22]. This was true in our translocation case, in which the sequenced portions of the der(X) chromosome contained both long interspersed nuclear elements (LINE/L1 and Line/L2 homologous sequences), enabling the exchange of genetic material during male meiosis. We have mapped the breakpoint of our patient with a 46,X,der(X)(t(X;Y)(p22.3;q11.21) translocation using FISH and SNP arrays, and cloned the breakpoint by long-range PCR and DNA sequencing.

The phenotype of females with Xp22;Yq11 translocations is usually stated to be normal except for short stature [2,22]. However, there has been no comprehensive analysis of published female cases, as most reports only contain one or several affected females; and follow up has only been reported for several patients. Upon an extensive literature review, at least 50 females with Xp22;Yq11 translocations have been reported (Table 1; Summary in Table 2). Critical review of these mostly isolated female cases indicates that there is considerably more phenotypic morbidity in many affected phenotypic females than is generally thought (Tables 1 and 2) [2-20]. We realize that there may be a certain degree of publication bias in that more severe phenotypes may be present in the literature. Nevertheless, this is the information now available to evaluate the phenotypic effects of this translocation.
Table 1

Reported Females with Xp22;Yq11 Translocations

No.

Reference

Index Case

Age at dx

Age at F/U

Menarche

Ovarian function reported (Fertility)

Stature

Endocrine Studies

AMH

Menopause

Other abnormalities

1

Khudr 1973 [3]

Female 46,X,t(X;Y)(p22;q11)

31

Not followed

12 yr

4 SABs; 1 daughter (G5P1041); regular menses

Short, 137 cm

FSH = 9.1mIU/ml; Normal LH & thyroid studies

Not measured

n/a

exploratory laparotomy revealed nl uterus, tubes, and cystic ovaries;

2

Van den Berghe 1977 (1) [4]

Female 46,X,t(Xp;Yq)

14

17 yr

14 yr

n/a

Short, 145 cm at 14yo; 150 cm at 17 yr

FSH = 5.8 mU/ml

Not measured

n/a

Bicornuate/slightly asymmetric with left horn less developed and filiform, fibrous tubes; nl appearing ovaries

3

Van den Berghe 1977 (2) [4]

Female 46,X,t(Xp;Yq)

37

Not followed

Unknown

G4; macerated normal looking male 8 mo; 1 full term female; 1 ?abnl male newborn (short) ; 1 nl male

Not reported

Not measured

Not measured

n/a

None reported or evaluated

4

Van den Berghe 1977 (3) [4]

Daughter of (2) 46,X, t(Xp;Yq)

2

Not followed

n/a

n/a

Short, birth 43 cm; 3rd percentile at 2 yr

Not measured

Not measured

n/a

None reported or evaluated

5

Akesson [5]

Swedish woman with 46,X,der(X),t(X;Y) (p22;ql1)

Not stated

n/a

Not given

Two affected male sons with ID & anomalies

150 cm

Not measured

Not measured

n/a

 

6

Johnston 1987 [7]

Female 46,X,t(X;Y)(p22;q11)

birth

7.5mo

n/a

Primordial follicles on ovarian bx

48.5 cm at 3 days old; 60.5 cm at 7.5 mo

FSH = 8.5 ng/mL at 12 days old; “Normal” at 7.5 mo

Not measured

n/a

Normal uterus by u/s and visual exam during surgery; imperforate anus, mesomelic dwarfism

7

Pfeiffer 1980 [6]

Female 46,X,t(X;Y)(p22;q11)

34

Not followed

14yo

G2; 1SAB; 1 abnl male

Short, 144.5 cm

Not measured

Not measured

n/a

Microcephaly, borderline ID

8

Agematsu 1988 [8]

Female 46,X,+der(X), t(X;Y)(p22.3q12);parents NA

28

30 yr

Unknown

Normal breasts; Apparent fertility; G1P1001; abnl son

151 cm

Not measured

Not measured

Unknown

Mildly short upper extremities; No punctate calcification by X-R

9

Al-Gazali 1990 [9]

De novo 46,X,t(X;Y)(p22;q11)

birth

8mo

n/a

Not determined

<5% at 8 mo

Not measured

Not measured

n/a

Linear skin defects with scalded appearance of upper neck & face, severe bilateral microphthalmia, left corneal opacity, syndactyly of 2nd/3rd toes of left foot, normal early developmental milestones

10

Al-Gazali 1990 [9]

De novo 46,X,t(X;Y)(p22;q11)

birth

2 yr 10mo

n/a

Not determined

<5% at 2 yr 10 mo

Not measured

Not measured

n/a

Bilateral microphthalmia, left orbital cyst, linear skin defects on face, neck, shoulder, & chest; anteriorly displaced anus; 1 cm sacral nevus, lack of sphincter control of bowel & bladder at 2 10/12 yr, problems walking long distances, otherwise normal developmental milestones

11

Kuznetzova 1994 [11]

Female 46,X,t(X;Y)(p22.3;q11)

12

14 yr

Unknown, but “normal” at 13 yr; normal breasts

n/a

Short

Normal FSH, LH, Estradiol; low Progesterone

Not measured

n/a

Hypoplastic uterus, short tubes, numerous follicles within ovaries; short neck; mild pectus excavatum;

12 to 32

Hsu 1994 [10]

25 females 46,X,+der(X),t(X;Y)(p22;q11); includes cases 1–4; 6

Unknown

Not followed

Unknown

“Proven fertility” or said to have nl ovaries in 20 of 25

17 of 22 with height info reported as short

Not measured

Not measured

Unknown

None reported or evaluated

33

Joseph 1996 (1) [13]

AA Female de novo 46,X,der(X)t(X;Y)(p22;q11)

prenatal

4 yr

n/a

n/a

Short, 71 cm (<5%) at 2 yr treated with growth hormone

At 23 mo, FSH = 3.0 mIU/ml, GnRH stimulation test normal; low GH

Not measured

n/a

Premature thelarche (T3 breasts); achieved 30% with GH at age 4

34 & 35

Joseph 1996 (2) [13]

Caucasion twin females with de novo 46,X,der(X)t(X;Y)(p22.3;q11.21)

prenatal

2 yr 10mo

n/a

n/a

Short, 81.5 cm and 81 cm at 2 yr (both <5%)

IGF-1 and IGFBP3 normal

Not measured

n/a

Dolichocephaly, Narrow flat face, downslanting palpebral fissures, & epicanthal folds

36

Joseph 1996 (3) [13]

White Female de novo 46,X,der(X)t(X;Y)(p22.3;q11)

prenatal

22mo

n/a

n/a

Short, 53.3 cm at birth and fell to 5th percentile at 22mo

IGF-1 and IGFBP3 normal

Not measured

n/a

None reported or evaluated

37

James 1998 (1) [12]

Female 46,t(X;Y)(p22.31;q11.21)

24.25

Not followed

Unknown

No evidence of ovarian failure

Short

Not reported

Not measured

n/a

Upslanting palpebral fissures, increased carrying angle, high arched palate

38

James 1998 (2) [12]

Female 46,X,t(X;Y)(p22.33;q12)

5.8

Not followed

n/a

n/a

Short

Not measured

Not measured

n/a

Convergent strabismus, edema

39

James 1998 (3) [12]

Female, mom of (2), 46,X,t(X;Y)(p22.33;q12)

48.9

Not followed

Unknown

No evidence of ovarian failure

Short

Not measured

Not measured

Unknown

Low posterior hairline, short, distal phalanges of thumbs, renal anomaly, schizoid disorder

40

James 1998(4) [12]

Female 46,X,der(X)t(X;Y)(p22.3;q11.2)

Unknown

Not followed

Unknown

n/a

Short

Not measured

Not measured

Unknown

Microphthalmia, linear skin defect

41

Guichet 1997 [17]

Female with de novo 46,X,t(X;Y)(p22.33;q11.23)

20

23 yr

14 yr

Unknown and stated that breasts developed after estrogen and progesterone treatment

Short, 146 cm

Not measured

Not measured

n/a

Madelung deformity; Small hands with moderate camptodactyly of 2-5th digits of hands; short feet with shortening of all toes and moderate syndactyly 2-5th toes; needed speech therapy

42

Calabrese 1999 [15]

Female with 46,X,der(X)t(X;Y)(p22.3;q11.21)

34

NA

NA

Ascertained through a son with LWD

150 cm

Not measured

Not measured

n/a

Bowing of radius & bilateral subluxation of distal ulna (Dx with Leri-Weill dyschondrosteosis)

43

Frints 2001 [16]

Female with 46,X,der(X)t(X;Y)(p22.3;q11.21)

Reported when son 1yo, mother “young”

Not followed

Unknown

G6; 3 male SBs, 2 healthy daughters, 1 abnormal term male

Normal, 161.3 cm (not short)

Not measured

Not measured

n/a

height 25-50%

44

Speevak 2001 [2]

Female with de novo 46,X,der(X)t(X;Y)(p22.3;q11.2)

prenatal

3 ¾ yr

n/a

n/a

Short, 50 cm at 6 weeks, below 3rd percentile at 3 ¾ years

Not measured

Not measured

n/a

None reported or evaluated

45

Bukvic 2010 (1) [14]

Female with 46,X,der(X),t(X;Y)(p22;q12)

20 m

Not followed

n/a

n/a

Short, 77 cm

Not measured

Not measured

n/a

Brachycephaly, mesomelia, mild developmental delay (IQ = 83), global motor delay, major linguistic deficits, mild facial dysmorphic features

46

Bukvic 2010 (2) [14]

Female with 46,X,der(X),t(X;Y)(p22;q12), mother of Bukvic case 1 (#42)

27

Not followed

Unknown

G6; 1 abnl male, 1 abnl female, 4 SABs within 10 weeks

159 cm

Not measured

Not measured

n/a

Mesomelia; Madelung deformity; normal IQ

47

Chen 2012 [18]

Female de novo with 46,X,der(X)t(X;Y)(p22.31;q11.221)

prenatal- 17 weeks

Termination of pregnancy 21 weeks

Unknown

n/a

25 cm at 21 weeks

Not measured

Not measured

n/a

Fetal demise, Shortening of humerus and femur

48

Palka-Bayard-de-Volo 2012 [20]

Female de novo with 46,X,der(X)t(X;Y)(p22;q11)

11y9mo

Not followed

n/a

n/a

Short, 44 cm at birth, −3.78 SD at eval (<5%)

Normal thyroid, IGF-1, & celiac studies; normal brain MRI

Not measured

n/a

Facial dysmorphism (hypertelorism, epicanthus, short philtrim, and simple external ear; ASD, psychomotor delay, major language impairment, mild ID (IQ = 70)

49

Cheng 2013 (1) [19]

Female with 46,X,der(X)t(X;Y)(p22;q11.2)

Unknown

Not followed

Unknown

G1, P1; abnormal male

150 cm

Not measured

Not measured

n/a

None reported or evaluated

50

Cheng 2013 (2) [19]

Female with 46,X,der(X)t(X;Y)(p22;q11.2)

Unknown

Not followed

“Normal”

2y hx infertility due to tubal disease; successful IVF; 2 previous TABs

Short, 1.51 m

Normal FSH, LH, Prolactin, 17-OH Preg, estradiol, & progesterone (values not provided)

Not measured

n/a

HSG showed blocked tubes; no uterine abnl reported

Table 2

Clinical characteristics of phenotypic females with Xp22;Yq11 translocations

Phenotype

Total (percent)

Details

 

All Ages

Reproductive age

 

Reproductive

   

Fertility

9/29 (31%)

9/10 (90%)

 

Delivery of normal child

4/29 (13.8%)

4/10 (40%)

4 of 10 adults had a normal child

Uterine anomaly

2/29 (6.9%)

 

Hypoplastic (n = 1); bicornuate (n = 1)

FSH Levels

6/29 (20.7%)

4/10 (40%)

All normal, but only 4 of reproductive age & none were done on cycle day 2-3

AMH Levels

0

 

None were reported

Follow up

11/29 (37.9%)

3/10 (30%)

No reports of repeat FSH or fertility evaluation

Gonadoblastoma

0

  

Nonreproductive

   

Short stature

27/29 (93.1%)

  

Intellectual disability

3/29 (10.3%)

 

Microcephaly/borderline ID (n = 1);Major language delay/mild ID with IQ =70 (n = 1); Mild developmental delay, IQ = 83, global motor delay, major linguistic deficits (n = 1)

Facial dysmorphism

8/29 (27.6%)

 

Linear skin defects of face (n = 3); upslanting palpebral fissures, brachycephaly, others

Eye abnormalities

4/29 (13.8%)

 

Microphthalmia (n = 3); strabismus (n =1)

Cardiac defects

1/29 (3.4%)

 

ASD

Skeletal defects

8/29 (27.6%)

 

Madelung, mesomelia, camptodactyly, syndactyly, others

Only included in this table are patients 1–11 and 33–50 since the details from Hsu (cases 9–29) are not provided. There are a total of 29 patients (all ages) and 11 that are reproductive age (defined as ≥17 years). ID = intellectual disability, ASD = atrial-septal defect. For full details including references, see Table 1.

While it is true that more than 90% of affected females have short stature, other significant phenotypic findings are commonly present and include mild intellectual disability (10%), facial dysmorphism (28%), eye abnormalities (14%), and skeletal defects (28%). One of 29 (3%) females had a congenital heart defect [20]. In cases where the female has been characterized, fertility has only been reported in 10 translocation patients and nine conceived; however only 4/10 (40%) had a normal child (Tables 1 and 2). Serum FSH to assess ovarian reserve has been performed (and is normal) in ~20% (6/29) of affected females, but was only reported in four postpubertal females—the time when it has clinical significance [23]. In the childhood period, FSH does not accurately reflect ovarian function, as gonadal failure cannot be differentiated from normal ovarian function [23]. Only three reproductive aged Xp22;Yq11 females have had short-term follow up, and no patient has had a cycle day 2–3 FSH (cycle day is not specified) or a random serum AMH level analyzed for ovarian reserve [21]. Therefore, ovarian reserve has not ever been adequately assessed in these previously reported women. Interestingly, in all published cases, we could not find any reports of a Xp22;Yq11 translocation female with a gonadoblastoma.

Our proband I1 is a normal female except for short stature, who has demonstrated normal reproductive function as evidenced by regular menses. Her ovarian reserve is normal with a normal cycle day #2 FSH at age 25; and normal day #2 FSH and AMH at age 32. She also had normal ovulatory response to superovulation with clomiphene. Her first child was a daughter (II1) with the same unbalanced translocation, who is also normal except for extreme short stature and attention deficit disorder. She has not yet had breast development at age 9. Short stature in these two females is at least partially explained by the heterozygous loss of the SHOX on the distal Xp22.3, which is thought to be involved in the short stature of Turner syndrome [24]. Patients with monosomy X (with or without mosaicism) have a 50% risk of congenital cardiac anomalies [25], so this was a concern in our patient who had monosomy for a large telomeric region of Xp. However, she does not have any murmurs and had a normal echocardiogram. She has been without any cardiac symptoms during her 7 year period of follow-up. These findings, as well as our identification of only one of 29 (3%) translocation patients having a cardiac anomaly (an atrioseptal defect) in the literature [20], suggest that the genes in this deleted region do not play a major role in the heart defects of Turner syndrome. However, it is also possible that our patient could develop aortic valve abnormalities and/or a dilated aortic root in the future, so careful follow up is recommended.

Our proband’s second pregnancy resulted in a stillborn male II2 with hydrocephalus, who inherited the derivative X chromosome from his mother. Since approximately 9.5 Mb of distal Xp containing 44 genes is deleted in this male, this likely resulted in embryonic lethality. Many of these genes are recognized to be involved in human genetic diseases and include: SHOX (dyschondrosteosis or Leri-Weill syndrome) [24], NLGN4 (autism and intellectual disability) [26], ARSE (chrondrodysplasia punctata, which has skeletal abnormalities and microcephaly) [27], VCX3A (implicated in intellectual disability) [28], and STS (ichthyosis) [29]. Since KAL1 is directly interrupted, it is likely this male would also have had Kallmann syndrome had he survived [30,31]. However, since this is an X-linked recessive disorder not affecting women, it is not expected that his mother would be affected with hypogonadotropic hypogonadism or anosmia (and she was not).

This couple received genetic counseling, including the possibility of preimplantation genetic diagnosis, which they declined. Fortunately, our proband had a normal term delivery of a reportedly normal male II3 in a subsequent pregnancy. The segregation of the der(X) within the family is what would be predicted. Since the mother is heterozygous for the der(X), she has a 50:50 chance of transmitting this to female offspring so that half of females would be expected to be short with other possible anomalies and the other half normal. In contrast, she has a 50:50 chance of passing the der(X) to a male which would result in deletion of 44 genes and probable lethality. If a male received her normal X chromosome, he would be expected to be normal. Although not karyotyped, her normal son is presumably 46,XY.

The presence of Yq11q12 sequences on der(X) in the female proband is unlikely to affect the phenotype. Since SRY (sex determining region on the Y chromosome) is localized to the distal Yp arm, its absence did not interfere with female sexual development. One to two megabase sequences in the pericentromeric region of Y, which may contain GBY (gonadoblastoma locus on the Y chromosome), are thought to contribute to the risk of gonadoblastomas and subsequent germ cell neoplasms of the ovaries in females with a Y chromosome [32]. Our patient has no evidence for this phenotype, and this is understandable given that the breakpoint at Yq11.21, which when revised after breakpoint cloning, is about 3.5 Mb away from this centromeric region. It is also possible that the GBY locus is in the pericentromeric region of Yp, which is not present in our patient. TSPY, another putative gonadoblastoma locus, is also localized to Yp and should not be present in this female proband. It is also reassuring that we were unable to document a female with t(X;Y)(p22;q11) with a gonadoblastoma (Tables 1 and 2). However, caution must be exercised since many of these patients had no published follow up, and follow up with tumor markers could be considered in her long term care.

The sequences from Yq11 include putative spermatogenesis genes documenting the presence of euchromatin on the der(X), but they are unlikely to be of any clinical significance in females. Our patient also had a uterine anomaly. Uterine anomalies were present in two of 29 cases found in the literature—one hypoplastic [11] and one bicornuate [4](Tables 1 and 2). However, it is unknown whether or not the translocation contributed to the (likely) bicornuate uterus in our patient.

Conclusion

In conclusion, mapping the breakpoint and cloning the junction fragment of the der(X) chromosome in our patient with a Xp22;Yq11 translocation resulted in the identification of a 9.5 Mb deletion of distal Xp22, which contains 44 genes. Our findings suggest that this der(X) in affected females: 1) does not affect regular menstruation or ovarian reserve; 2) does not preclude fertility; 3) results in short stature; 4) does not result in gonadoblastomas in females by age 32; 5) does not result in structural cardiac disease in females like 45,X individuals; and 6) results in the loss of 44 genes that collectively are probably lethal in affected males. Additionally, significant morbidity in the form of intellectual disability (10%), facial dysmorphism (28%), eye abnormalities (14%), and skeletal defects (28%) may occur in affected females, which should be considered in the genetic counseling of these patients.

Methods

When the patient was seen at Georgia Regents University, karyotypes were performed on the proband I1 and her healthy daughter II1 using standard G banding methods from peripheral white blood cells (WBCs) [33]. She signed a consent to have her records reviewed and to have blood drawn for molecular studies, which were approved by the Human Assurance Committee of Georgia Regents University. A lymphoblastoid cell line was created by infecting WBCs with Epstein-Barr virus and using cyclosporine A as described previously [34]. FISH was performed on metaphase chromosomes using standard methods with five fluorescently labeled probes including: X centromere (DXZ1), Y centromere (DYZ3), Yq12 (DYZ1), STS, and KAL1 genes. A Genome-Wide Human SNP Array 6.0, which features 1.8 million genetic markers, including more than 906,600 single nucleotide polymorphisms (SNPs) and more than 946,000 probes, was used to exclude copy number variants (CNV) and narrow the breakpoint. The Affymetrix GeneChip Command Console (AGCC) was used to scan the chips and the Genotype Console 2.0 was used to analyze the data to generate microarray results.

Long–range polymerase chain reaction (PCR) was performed to amplify the junction fragment of the derivative X chromosome. Primers were designed to amplify only fragments that contained both X and Y sequences (Table 3). Primers were Y-2040for and X-4177rev (to yield a 9 kb fragment), Y-6440for and X-2150rev (to yield a 4 kb fragment), and Y-4140for and X-5891rev (to yield a 10 kb fragment). PCR conditions included a 93°C denaturation step for 3 minutes, followed by 35 cycles of 93°C for 15 seconds, 62°C for 30 seconds, and 68°C for 10 minutes. PCR products were then electrophoresed on 1.2% agarose gels in the presence of a molecular weight marker, stained with ethidium bromide, and photographed. Nested PCR using internal primers was then used to amplify the junction fragment of the breakpoint region. The resulting PCR products were then ethanol precipitated and sequenced using the dideoxy method with the Big Dye Terminator Kit and run on the ABI 310 Automated DNA Sequencer [35]. Multiple bioinformatic databases were utilized including Human Genome Browser (http://genome.ucsc.edu/), Repeat Masker Web Server (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker), ClustalW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html) and WWW READSEQ Sequence Conversion (http://www-bimas.cit.nih.gov/molbio/readseq).
Table 3

Primers used to amplify the junction fragments

Primer

Sequence (5′ → 3′)

Xp22.31-2150rev

AGATGTGGCAGCATCTTGTTAGTGTACTGGTTAAGTC

Xp22.31-4177rev

CACATTGCATATGTCTCATTGTGAGGAGCATCC

Xp22.31-5891rev

GTGACATGTTCCCTGTGCTCTGTGACATGTC

Yq11.2-2040for

AGTAAGGATCTTTCGACATTTGGTGAGAATGAGAAACAGA

Yq11.2-4140for

GTCTGAAACCCAGGATCCGGAAGTGGG

Yq11.2-6440for

CTTACATAGGAATATGCAGACACATTAACACCTTGTGCTC

To determine which Yq11 sequences were contained in the der(X) chromosome, 19 sequence tagged sites (STS) on various regions were amplified according to the instructions of the Y Chromosome Deletion Detection System Version 2.0 (Promega; Madison, WI) and electrophoresed on 1.2% agarose gels.

Declarations

Acknowledgements

LCL supported by NIH grant HD33004. This paper is dedicated to Krista H. Layman, who will be forever missed.

Authors’ Affiliations

(1)
Department of Obstetrics & Gynecology, Medical College of Georgia, Georgia Regents University
(2)
Section of Reproductive Endocrinology, Infertility, & Genetics, Medical College of Georgia, Georgia Regents University
(3)
Department of Surgery and Department of Pathology, Anatomy & Cell Biology, Thomas Jefferson University
(4)
Section of Reproductive Endocrinology, Infertility, & Genetics, Department of Obstetrics & Gynecology, Medical College of Georgia, Georgia Regents University

References

  1. Yen PH, Tsai SP, Wenger SL, Steele MW, Mohandas TK, Shapiro LJ. X/Y translocations resulting from recombination between homologous sequences on Xp and Yq. Proc Natl Acad Sci U S A. 1991;88(20):8944–8.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Speevak M, Farrell SA, Chadwick D. Molecular and cytogenetic characterization of a prenatally ascertained de novo (X;Y) translocation. Am J Med Genet. 2001;98(1):107–8.View ArticlePubMedGoogle Scholar
  3. Khudr G, Benirschke K, Judd HL, Strauss J. Y to X translocation in a woman with reproductive failure. A new rearrangement JAMA. 1973;226(5):544–9.Google Scholar
  4. van den Berghe H, Petit P, Fryns JP. Y to X translocation in man. Hum Genet. 1977;36(2):129–41.View ArticlePubMedGoogle Scholar
  5. Akesson HO, Hagberg B, Wahlstrom J. Y-to-X chromosome translocation observed in two generations. Hum Genet. 1980;55(1):39–42.View ArticlePubMedGoogle Scholar
  6. Pfeiffer RA. Observations in a case of an X/Y translocation, t(X;Y)(p22;q11), in a mother and son. Cytogenet Cell Genet. 1980;26(2–4):150–7.View ArticlePubMedGoogle Scholar
  7. Johnston K, Schonberg S, Littman V, Gregory T, Gelbart S, O’Donnell J, et al. De novo X;Y translocation associated with imperforate anus and retinal pigmentary abnormalities. Am J Med Genet. 1987;27(3):603–11.View ArticlePubMedGoogle Scholar
  8. Agematsu K, Koike K, Morosawa H, Nakahori Y, Nakagome Y, Akabane T. Chondrodysplasia punctata with X;Y translocation. Hum Genet. 1988;80(1):105–7.View ArticlePubMedGoogle Scholar
  9. al-Gazali LI, Mueller RF, Caine A, Antoniou A, McCartney A, Fitchett M, et al. Two 46,XX,t(X;Y) females with linear skin defects and congenital microphthalmia: a new syndrome at Xp22.3. J Med Genet. 1990;27(1):59–63.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Hsu LY. Phenotype/karyotype correlations of Y chromosome aneuploidy with emphasis on structural aberrations in postnatally diagnosed cases. Am J Med Genet. 1994;53(2):108–40.View ArticlePubMedGoogle Scholar
  11. Kuznetzova T, Baranov A, Ivaschenko T, Savitsky GA, Lanceva OE, Wang MR, et al. X;Y translocation in a girl with short stature and some features of Turner’s syndrome: cytogenetic and molecular studies. J Med Genet. 1994;31(8):649–51.View ArticlePubMedPubMed CentralGoogle Scholar
  12. James RS, Coppin B, Dalton P, Dennis NR, Mitchell C, Sharp AJ, et al. A study of females with deletions of the short arm of the X chromosome. Hum Genet. 1998;102(5):507–16.View ArticlePubMedGoogle Scholar
  13. Joseph M, Cantu ES, Pai GS, Willi SM, Papenhausen PR, Weiss L. Xp pseudoautosomal gene haploinsufficiency and linear growth deficiency in three girls with chromosome Xp22;Yq11 translocation. J Med Genet. 1996;33(11):906–11.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Bukvic N, Carri VD, Di Cosola ML, Pustorino G, Cesarano C, Chetta M, et al. Familial X;Y translocation with distinct phenotypic consequences: Characterization using FISH and array CGH. Am J Med Genet A. 2010;152A(7):1730–4.View ArticlePubMedGoogle Scholar
  15. Calabrese G, Fischetto R, Stuppia L, Capodiferro F, Mingarelli R, Causio F, et al. X/Y translocation in a family with Leri-Weill dyschondrosteosis. Hum Genet. 1999;105(4):367–8.View ArticlePubMedGoogle Scholar
  16. Frints SG, Fryns J, Lagae L, Syrrou M, Marynen P, Devriendt K. Xp22.3; Yq11.2 chromosome translocation and its clinical manifestations. Ann Genet. 2001;44(2):71–6.View ArticlePubMedGoogle Scholar
  17. Guichet A, Briault S, Le Merrer M, Moraine C. Are t(X;Y) (p22;q11) translocations in females frequently associated with Madelung deformity? Clin Dysmorphol. 1997;6(4):341–5.View ArticlePubMedGoogle Scholar
  18. Chen CP, Su YN, Chern SR, Su JW, Chen YT, Lee CC, et al. Prenatal diagnosis and array comparative genomic hybridization characterization of a de novo X;Y translocation. Taiwan J Obstet Gynecol. 2012;51(3):485–8.View ArticlePubMedGoogle Scholar
  19. Cheng DH, Gong F, Tan K, Lu CR, Lin G, Lu GX, et al. Karyotype determination and reproductive guidance for short stature women with a hidden Y chromosome fragment. Reprod Biomed Online. 2013;27(1):89–95.View ArticlePubMedGoogle Scholar
  20. Palka-Bayard-de-Volo C, De Marco S, Chiavaroli V, Alfonsi M, Calabrese G, Chiarelli F, et al. Array-CGH characterization of a de novo t(X;Y)(p22;q11) in a female with short stature and mental retardation. Gene. 2012;504(1):107–10.View ArticlePubMedGoogle Scholar
  21. Nelson SM. Biomarkers of ovarian response: current and future applications. Fertil Steril. 2013;99(4):963–9.View ArticlePubMedGoogle Scholar
  22. Bernstein R. X;Y Chromosome Translocations and their Manifestations. In: Sandberg AE, editor. The Y Chromosome, Part B: Clinical Aspects of Y Chromosome Abnormalities. New York, New York: Alan R. Liss, Inc; 1985. p. 171–206.Google Scholar
  23. Layman LC, Reindollar RH. The diagnosis and treatment of pubertal disorders. Adolesc Med: State of the art reviews. 1994;5:37–55.Google Scholar
  24. Belin V, Cusin V, Viot G, Girlich D, Toutain A, Moncla A, et al. SHOX mutations in dyschondrosteosis (Leri-Weill syndrome). Nat Genet. 1998;19(1):67–9.View ArticlePubMedGoogle Scholar
  25. Zhong Q, Layman LC. Genetic considerations in the patient with Turner syndrome–45, X with or without mosaicism. Fertil Steril. 2012;98(4):775–9.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Jamain S, Quach H, Betancur C, Rastam M, Colineaux C, Gillberg IC, et al. Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism. Nat Genet. 2003;34(1):27–9.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Franco B, Meroni G, Parenti G, Levilliers J, Bernard L, Gebbia M, et al. A cluster of sulfatase genes on Xp22.3: mutations in chondrodysplasia punctata (CDPX) and implications for warfarin embryopathy. Cell. 1995;81(1):15–25.View ArticlePubMedGoogle Scholar
  28. Fukami M, Kirsch S, Schiller S, Richter A, Benes V, Franco B, et al. A member of a gene family on Xp22.3, VCX-A, is deleted in patients with X-linked nonspecific mental retardation. Am J Hum Genet. 2000;67(3):563–73.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Basler E, Grompe M, Parenti G, Yates J, Ballabio A. Identification of point mutations in the steroid sulfatase gene of three patients with X-linked ichthyosis. Am J Hum Genet. 1992;50(3):483–91.PubMedPubMed CentralGoogle Scholar
  30. Legouis R, Hardelin JP, Levilliers J, Claverie JM, Compain S, Wunderle V, et al. The candidate gene for the X-linked Kallmann syndrome encodes a protein related to adhesion molecules. Cell. 1991;67(2):423–35.View ArticlePubMedGoogle Scholar
  31. Franco B, Guioli S, Pragliola A, Incerti B, Bardoni B, Tonlorenzi R, et al. A gene deleted in Kallmann’s syndrome shares homology with neural cell adhesion and axonal path-finding molecules. Nature. 1991;353(6344):529–36.View ArticlePubMedGoogle Scholar
  32. Tsuchiya K, Reijo R, Page DC, Disteche CM. Gonadoblastoma: molecular definition of the susceptibility region on the Y chromosome. Am J Hum Genet. 1995;57(6):1400–7.PubMedPubMed CentralGoogle Scholar
  33. Bhagavath B, Podolsky RH, Ozata M, Bolu E, Bick DP, Kulharya A, et al. Clinical and molecular characterization of a large sample of patients with hypogonadotropic hypogonadism. Fertil Steril. 2006;85(3):706–13.View ArticlePubMedGoogle Scholar
  34. Xu N, Kim HG, Bhagavath B, Cho SG, Lee JH, Ha K, et al. Nasal embryonic LHRH factor (NELF) mutations in patients with normosmic hypogonadotropic hypogonadism and Kallmann syndrome. Fertil Steril. 2011;95(5):1613–20. e1611-1617.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Kim HG, Kurth I, Lan F, Meliciani I, Wenzel W, Eom SH, et al. Mutations in CHD7, encoding a chromatin-remodeling protein, cause idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Am J Hum Genet. 2008;83(4):511–9.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© Dobek et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement