Skip to main content

Table 3 Primers used to amplify the junction fragments

From: Long-term follow-up of females with unbalanced X;Y translocations—reproductive and nonreproductive consequences

Primer Sequence (5′ → 3′)
Xp22.31-2150rev AGATGTGGCAGCATCTTGTTAGTGTACTGGTTAAGTC
Xp22.31-4177rev CACATTGCATATGTCTCATTGTGAGGAGCATCC
Xp22.31-5891rev GTGACATGTTCCCTGTGCTCTGTGACATGTC
Yq11.2-2040for AGTAAGGATCTTTCGACATTTGGTGAGAATGAGAAACAGA
Yq11.2-4140for GTCTGAAACCCAGGATCCGGAAGTGGG
Yq11.2-6440for CTTACATAGGAATATGCAGACACATTAACACCTTGTGCTC