Skip to main content

Table 2 Nucleotide sequence of RTq-PCR primers

From: Identifying novel genetic alterations in pediatric acute lymphoblastic leukemia based on copy number analysis

Genes Primers (5′-3′) Size (bp) Position Exons
TCF3 CTACTCCCCGGATCACTCAA 20 1086–1105 13
PBX1 AGGCTTCATTCTGTGGCAGT 20 3893–3912 2
MLL CGCCCAAGTATCCCTGTAAA 20 4071–4090 8
AF4 GAGCATGGATGACGTTCCTT 20 1546–1565 8
BCR TCGCAGAACTCGCAACAGT 19 1707–1725 1
ABL ACACCATTCCCCATTGTGAT 20 284–303 3
ETV6 TCTCTCATCGGGAAGACCTG 20 1191–1210 5
RUNX1 TGCGGTAGCATTTCTCAGC 19 619–637 5
SIL TCCTACCCTGCAAACAGACC 20 73–92 1
TAL1 AGGCGGAGGATCTCATTCTT 20 1250–1269 4