Skip to main content

Advertisement

Table 1 List of specific primers used for determination of telomere length

From: Can telomere shortening be the main indicator of non-viable fetus elimination?

Primer name Sequence (5ā€²-3ā€²)
Tel 1 GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT
Tel 2 TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA
36B4u CAGCAAGTGGGAAGGTGTAATCC
36B4d CCCATTCTATCATCAACGGGTACAA