Skip to main content

Table 1 Primers used for qPCR in this study

From: The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability

Name Primer sequence (5’ → 3’)
Forward Reverse
chr1q21.1 #1 TGAGCAGTTCAAAGGAGTGTAG ATGACCCACAAAGTGAGAGAAA
chr1q21.1 #2 AAGGCTGTGAAGGAGGAAATC CTGACCAGGCAGAAGACATAAA
chr7q11 GGAGCACAAAGCAACTGAATG AGACAGCAATGCAGAGGAA
chrXq28 #1 AGAGCTCGGACTCCATCTAAT CCTTCCCATGTCAGTGTGTTAT
chrXq28 #2 CTCACTTCTGGGTCTCACATTC AATCCCAAGTGACTTCCAAGG
GAPDH GATCATCAGCAATGCCTCCT ATGGCATGGACTGTGGTCAT