Deletions and duplications of the 22q11.2 region in spermatozoa from DiGeorge/velocardiofacial fathers

Table 3 Microsatellite markers used to determine the parental origin

Microsatellite	Position	Primers	Labelling	Lenght (bp)	Annealing temperature
D22S1638 ^a	22q11.21	F: GACAACAGCAAATTGCACATT	HEX	93	55 C
D22S1638 ^a	22q11.21	R: TCACGCCACTACCCTCCAG	HEX	93	55 C
D22S1648 ^a	22q11.21	F: CAGATGCTTCAGGAGAAGTG	HEX	152	50 C
D22S1648 ^a	22q11.21	R: AGTTGTCAGATGCCTAAGAGA	HEX	152	50 C
D22S264 ^a	22q11.21	F: ATTAACTCATAAAGGAGCCC	HEX	190-198	56 C
D22S264 ^a	22q11.21	R: CACCCCACCAGAGGTATTCC	HEX	190-198	56 C
D22S311 ^a	22q11.21	F: GCTAGTGTGAGATAACGAAGCC	6-FAM	262	63 C
D22S311 ^a	22q11.21	R: TTTTTGTATTTTTAGTAGAGACGG	6-FAM	262	63 C
D22S303 ^b	22q11.22	F: AGGACCTCAGACTGGTCAGTC	6-FAM	220-233	56 C
D22S303 ^b	22q11.22	R: CTCCCATGAGAAGGTACACTCC	6-FAM	220-233	56 C

^aMicrosatellites inside the deleted region.
^bMicrosatellite outside the deleted region.
Table shows the forward (F) and reverse (R) primers, the 5′ labelling in the forward primers, the size of the amplified markers and their chromosomal position.

ISSN: 1755-8166